Difference between revisions of "Part:BBa K1875017"

Line 6: Line 6:
 
The BostonU 2016 iGEM team’s Gemini Library contains analog parts in addition to their digital parts.  They synthesized multimerized binding sites to increase the expression of the operator. This hypothesis was supported by analogous results in previous synthetic transcriptional regulator research. A multimerized operator means that there are consecutive operators upstream of the promoter where the dCas9-VPR and guide RNA will bind to.  In addition to multimerizing operator sites, BostonU 2016 also modulated the space between the binding sites. Figure 2 demonstrates a screen with this multimerized operator containing the target for g13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the strongest of its double multimerized operators which had a 24 base pair spacer between the operators.
 
The BostonU 2016 iGEM team’s Gemini Library contains analog parts in addition to their digital parts.  They synthesized multimerized binding sites to increase the expression of the operator. This hypothesis was supported by analogous results in previous synthetic transcriptional regulator research. A multimerized operator means that there are consecutive operators upstream of the promoter where the dCas9-VPR and guide RNA will bind to.  In addition to multimerizing operator sites, BostonU 2016 also modulated the space between the binding sites. Figure 2 demonstrates a screen with this multimerized operator containing the target for g13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the strongest of its double multimerized operators which had a 24 base pair spacer between the operators.
  
[[File:T--BostonU--2xpGOP_circle_map.png|300px|thumb|left|Figure 1: Double multimerized gRNA operator reporter plasmid map]]
+
[[File:T--BostonU--2xpGOP_circle_map.png|400px|thumb|left|Figure 1: Double multimerized gRNA operator reporter plasmid map]]
 +
 
 +
[[File:T--BostonU--g13_multimerized.png|400px|thumb|center|Figure 2: Screen of GFP expression in double and triple multimerized operator reporters (containing g13) with and without the gRNA expression vector]]
 +
 
 +
 
 +
 
  
[[File:T--BostonU--g13_multimerized.png|300px|thumb|center|Figure 2: Screen of GFP expression in double and triple multimerized operator reporters (containing g13) with and without the gRNA expression vector]]
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Revision as of 03:27, 18 October 2016

This operator, when paired with a guide RNA, expresses GFP.

Double Operator

The BostonU 2016 iGEM team’s Gemini Library contains analog parts in addition to their digital parts. They synthesized multimerized binding sites to increase the expression of the operator. This hypothesis was supported by analogous results in previous synthetic transcriptional regulator research. A multimerized operator means that there are consecutive operators upstream of the promoter where the dCas9-VPR and guide RNA will bind to. In addition to multimerizing operator sites, BostonU 2016 also modulated the space between the binding sites. Figure 2 demonstrates a screen with this multimerized operator containing the target for g13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the strongest of its double multimerized operators which had a 24 base pair spacer between the operators.

Figure 1: Double multimerized gRNA operator reporter plasmid map
Figure 2: Screen of GFP expression in double and triple multimerized operator reporters (containing g13) with and without the gRNA expression vector



Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 974
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]