Difference between revisions of "Part:BBa K2060000:Design"
(→‎Design Notes)
Line 8: Line 8:
 
===Design Notes===
 
===Design Notes===
 
One of the Cardiff_Wales iGEM instructors Daniel Pass, designed a [https://github.com/passdan/scriptdrop/blob/master/cas9_targeter.py bioinformatic tool] for the selection of appropriate guide RNAs that adhered to the following rules:
 
One of the Cardiff_Wales iGEM instructors Daniel Pass, designed a [https://github.com/passdan/scriptdrop/blob/master/cas9_targeter.py bioinformatic tool] for the selection of appropriate guide RNAs that adhered to the following rules:
−
Use the following guidelines to select a genomic DNA region that corresponds to the crRNA sequence of the sgRNA:
+
<p>Use the following guidelines to select a genomic DNA region that corresponds to the crRNA sequence of the sgRNA:
−
        - The 3' end of the DNA target sequence must have a proto-spacer adjacent motif (PAM) sequence (5'-NGG-3').
+
      <p> - The 3' end of the DNA target sequence must have a proto-spacer adjacent motif (PAM) sequence (5'-NGG-3').
 
         - The 20 nucleotides upstream of the PAM sequence will be your targeting sequence (crRNA) and Cas9 nuclease will cleave approximately 3 bases upstream of the PAM.
 
         - The 20 nucleotides upstream of the PAM sequence will be your targeting sequence (crRNA) and Cas9 nuclease will cleave approximately 3 bases upstream of the PAM.
 
         - The PAM sequence itself is absolutely required for cleavage, but it is NOT part of the sgRNA sequence and therefore should not be included in the sgRNA.
 
         - The PAM sequence itself is absolutely required for cleavage, but it is NOT part of the sgRNA sequence and therefore should not be included in the sgRNA.
Line 24: Line 24:
  
 
Used standard design considerations for guide RNAs
 
Used standard design considerations for guide RNAs
−
 
−
 
  
 
===Source===
 
===Source===

Revision as of 14:57, 17 October 2016


CRISPR-Cas9 guide RNA targeting to 16S RNA


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 48
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

One of the Cardiff_Wales iGEM instructors Daniel Pass, designed a bioinformatic tool for the selection of appropriate guide RNAs that adhered to the following rules:

Use the following guidelines to select a genomic DNA region that corresponds to the crRNA sequence of the sgRNA: <p> - The 3' end of the DNA target sequence must have a proto-spacer adjacent motif (PAM) sequence (5'-NGG-3'). - The 20 nucleotides upstream of the PAM sequence will be your targeting sequence (crRNA) and Cas9 nuclease will cleave approximately 3 bases upstream of the PAM. - The PAM sequence itself is absolutely required for cleavage, but it is NOT part of the sgRNA sequence and therefore should not be included in the sgRNA. - The target sequence can be on either DNA strand. The sequence is below has the Forward guide sequence and the General Scaffold sequences highlighted. This was synthesised as a single fragment and we aimed to directly clone this fragment into pSB1C3 using EcoRI and PstI. However we were unable to identify a clone with the correct sequence. Therefore this aspect of the project will continue during future related research. GTCATCCTCTCAGACCAGCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GGTGGGGTAACGGCTCACCA Used standard design considerations for guide RNAs

Source

E.coli 16S ribosomal RNA

===References===