Difference between revisions of "Part:BBa K2075020:Design"

Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
taggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgcttctagagaataattttgtttaactttaagaaggagatactagatgatcaaaatagccacacgtaaatatttaggcaaacaaaatgtctatgacattggagttgagcgcgaccataattttgcactcaaaaatggcttcatagcttccaactgtttcaatggcggttcgggcggttcgggcggcacaggcggttcgggcggttctatgtacccatacgatgttcctgactatgcggccaagaagaagaggaaggtgcaggtggatctacgcacgctcggctacagccagcagcaacaggagaagatcaaaccgaaggttcgttcgacagtggcgcagcaccacgaggcactggtcggccatgggtttacacacgcgcacatcgttgcgctcagccaacacccggcagcgttagggaccgtcgctgtcaagtatcaggacatgatcgcagcgttgccagaggcgacacacgaagcgatcgttggcgtcggcaaacagtggtccggcgcacgcgctctggaggccttgctcacggtggcgggagagttgagaggtccaccgttacagttggacacaggccaacttctcaagattgcaaagcgtggcggcgtgaccgcagtggaggcagtgcatgcatggcgcaatgcactgacgggtgcccccctgaaccttaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaataacggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgacaccggagcaggtggtggccatcgccagccacgatggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctcaccccggagcaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgactccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcgcatggccttaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgacaccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctcaccccggagcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgactccggagcaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcgcatggccttaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgacaccggagcaggtggtggccatcgccagccacgatggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctcaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgactccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagagcattgttgcccagttatctcgccctgatccgtcgttggccgcgttaaccaacgaccacctcgtcgccttggcctgcctcggcggacgtcctgcgctggatgcagtgaaaaagggattgccgcacgcgccggccttgatcaaaagaaccaatcgccgtattcccgaacgcacatcccatcgcgttgccggatcccagctggtgaagagcgagctggaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccacgagtacatcgagctgatcgagatcgccaggaaccccacccaggaccgcatcctggagatgaaggtgatggagttcttcatgaaggtgtacggctacaggggagagcacctgggcggaagcagaaagcctgacggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtggacacaaaggcctacagcggcggctacaatctgcctatcggccaggccgacgcgatgcagagctacgtggaggagaaccagacccggaataagcacatcaaccccaacgagtggtggaaggtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggcaactacaaggcccagctgaccaggctgaaccacatcaccaactgcaatggcgccgtgctgagcgtggaggagctgctgatcggcggcgagatgatcaaagccggcaccctgacactggaggaggtgcggcgcaagttcaacaacggcgagatcaacttcagatcttgaaggtgtggagaatttgtacttccagtcacaagttgtcttcagcgcgtggagccatccgcagtttgaaaaaggcggtgcgagcggtggcggcagcggtggcagcgcgtggagccatccgcagtttgaaaaaggtggcgaagactacaagggtggtgcggagtactgcttaagctatgaaacggaaatattgacagtagaatatggattattaccgattggtaaaattgtagaaaagcgcatcgaatgtactgtttatagcgttgataataatggaaatatttatacacaacctgtagcacaatggcacgatcgcggagaacaagaggtgtttgagtattgtttggaagatggttcattgattcgggcaacaaaagaccataagtttatgactgttgatggtcaaatgttgccaattgatgaaatatttgaacgtgaattggatttgatgcgggttgataatttgccgaattaa
+
This composite part includes an Intein and linker, the TAL-effector Ax7L-DS, a TEV Site and a Strep XT Tag. They are translated all together.
 +
 
 +
The intein and linker are important to circularice the aminoacid sequence between the N- and C-terminal parts. Between the Intein sites is the TAL-effector and the TEV Site. There is also a strep XT tag. When it is translated the intein sites react and form a circularised protein. All the parts between N- and C-Terminal Intein is part of the protein circle. In this circle the hole protein gains more stability.
 +
With the help of the strep TX tag the protein can be purified even if it is circularised. The Strep XT Tag is also usefull to detect the protein with an immunostain. The TEV Site give the opportunity to linearise the protein again wit the help oft he TEV protease. The linearised TAL can bind the specific DNA Sequence. The 12th and 13th amino acid of each of the 11.5 repeats from our TAL Hax3 – 2xNN are: NI NN HD NI HD NG NI NG NI NG NI NI NI HD HD HD HD HD They bind the DNA sequence: A G/A C A C T A T A T A A A C C C C C
  
 
===Source===
 
===Source===

Revision as of 20:28, 15 October 2016


TAL-effector Ax7L-DS


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 3202
    Illegal BamHI site found at 2608
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 2547
    Illegal NgoMIV site found at 3142
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 2622


Design Notes

This composite part includes an Intein and linker, the TAL-effector Ax7L-DS, a TEV Site and a Strep XT Tag. They are translated all together.

The intein and linker are important to circularice the aminoacid sequence between the N- and C-terminal parts. Between the Intein sites is the TAL-effector and the TEV Site. There is also a strep XT tag. When it is translated the intein sites react and form a circularised protein. All the parts between N- and C-Terminal Intein is part of the protein circle. In this circle the hole protein gains more stability. With the help of the strep TX tag the protein can be purified even if it is circularised. The Strep XT Tag is also usefull to detect the protein with an immunostain. The TEV Site give the opportunity to linearise the protein again wit the help oft he TEV protease. The linearised TAL can bind the specific DNA Sequence. The 12th and 13th amino acid of each of the 11.5 repeats from our TAL Hax3 – 2xNN are: NI NN HD NI HD NG NI NG NI NG NI NI NI HD HD HD HD HD They bind the DNA sequence: A G/A C A C T A T A T A A A C C C C C

Source

Source info goes here

References

References go here