Difference between revisions of "Part:BBa K1875012"
Line 2: | Line 2: | ||
<partinfo>BBa_K1875012 short</partinfo> | <partinfo>BBa_K1875012 short</partinfo> | ||
− | This | + | This part can be used to express a guide RNA (g8) from BostonU 2016’s project Gemini. Specifically, this part expresses g8, a guide RNA that directly recognizes the 20bp target sequence 5’ GTTGCGCGTCCGTATCAAGG 3’. This 20bp target sequence can be found in composite part BBa_K1875004. |
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8. | We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8. |
Revision as of 17:43, 15 October 2016
This part produces a guide RNA that pairs with an operator.
This part can be used to express a guide RNA (g8) from BostonU 2016’s project Gemini. Specifically, this part expresses g8, a guide RNA that directly recognizes the 20bp target sequence 5’ GTTGCGCGTCCGTATCAAGG 3’. This 20bp target sequence can be found in composite part BBa_K1875004.
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8. Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 247
- 1000COMPATIBLE WITH RFC[1000]