Difference between revisions of "Part:BBa K1875012"

Line 2: Line 2:
 
<partinfo>BBa_K1875012 short</partinfo>
 
<partinfo>BBa_K1875012 short</partinfo>
  
This composite part can be used to express a guide RNA (g8) from BostonU 2016’s project Gemini. Specifically, this part expresses g8, a guide RNA that directly recognizes the 20bp target sequence 5’ GTTGCGCGTCCGTATCAAGG 3’. This 20bp target sequence can be found in composite part BBa_K1875004.  
+
This part can be used to express a guide RNA (g8) from BostonU 2016’s project Gemini. Specifically, this part expresses g8, a guide RNA that directly recognizes the 20bp target sequence 5’ GTTGCGCGTCCGTATCAAGG 3’. This 20bp target sequence can be found in composite part BBa_K1875004.  
  
 
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8.
 
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8.

Revision as of 17:43, 15 October 2016

This part produces a guide RNA that pairs with an operator.

This part can be used to express a guide RNA (g8) from BostonU 2016’s project Gemini. Specifically, this part expresses g8, a guide RNA that directly recognizes the 20bp target sequence 5’ GTTGCGCGTCCGTATCAAGG 3’. This 20bp target sequence can be found in composite part BBa_K1875004.

We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8. Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 247
  • 1000
    COMPATIBLE WITH RFC[1000]