Difference between revisions of "Part:BBa K1875011"

Line 5: Line 5:
 
Guide RNA g3 Expression Part
 
Guide RNA g3 Expression Part
  
This composite part can be used to express a guide RNA (g3) from BostonU 2016’s project Gemini. Specifically, this part expresses g3, a guide RNA that directly recognizes the 20bp target sequence 5’ AATGAACCTATTCGTACCGT 3’. This 20bp target sequence can be found in composite part BBa_K1875003.  
+
This part can be used to express a guide RNA (g3) from BostonU 2016’s project Gemini. Specifically, this part expresses g3, a guide RNA that directly recognizes the 20bp target sequence 5’ AATGAACCTATTCGTACCGT 3’. This 20bp target sequence can be found in composite part BBa_K1875003.  
  
 
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875000 (this composite part with g3), a plasmid with BBa_K1875003 (the corresponding GFP reporter composite part with g3’s target sequence), and a plasmid expressing dCas9-VPR.  We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3.
 
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875000 (this composite part with g3), a plasmid with BBa_K1875003 (the corresponding GFP reporter composite part with g3’s target sequence), and a plasmid expressing dCas9-VPR.  We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3.

Revision as of 17:42, 15 October 2016

This part produces a guide RNA that pairs with an operator.


Guide RNA g3 Expression Part

This part can be used to express a guide RNA (g3) from BostonU 2016’s project Gemini. Specifically, this part expresses g3, a guide RNA that directly recognizes the 20bp target sequence 5’ AATGAACCTATTCGTACCGT 3’. This 20bp target sequence can be found in composite part BBa_K1875003.

We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875000 (this composite part with g3), a plasmid with BBa_K1875003 (the corresponding GFP reporter composite part with g3’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]