Latest revision as of 09:25, 15 October 2016

pBS0KPspac, an IPTG-inducible replicative expression vector for

pBS0KPspac, an IPTG-inducible replicative expression vector for Bacillus subtilis. It is replicative both in E.coli and B.subtilis. It has an ampicillin resistance for cloning in E.coli and kanamycin resistance for selection in B. subtilis. The multiple cloning site is downstream of a P_spac promoter, that is inducible with IPTG (Isopropyl-β-D-thiogalactopyranosid).

pSB_Bs0K-P_spac is a replicative expression vector with a kanamycin resistance. The IPTG (isopropylbeta-D-thiogalactopyranoside)-inducible Promoter P_spac is followed by the multiple cloning site and a terminator. Also expressed are lacY, a transporter for IPTG (naturally allolactose), and lac, the repressor. In presence of IPTG, LacI releases from the promoter and the gene of interest is expressed.

The ble gene encodes the bleomycin resisitance protein (BRP) which can be selected for by bleomycine or phleomycin in E. coli and B. subtilis. We did not use this resistance.

The presence of the vector can be checked for via colony PCR with the primers: CTACATCCAGAACAACCTCTGC and TTCGGAAGGAAATGATGACCTC. This backbone is a BioBricked version of the B. subtilis overexpression vector pDG148. Reference: [http://www.ncbi.nlm.nih.gov/pubmed/11728721 Joseph et al.] For handling of B. subtilis vectors, please see here. The transformation into B. subtilis is explained here. This is the "repaired" version of pSB_Bs0K-P_spac, where a single nucleotide loss of the lacI gene was reintroduced.

Fluorescence of GFP under expression of promoter P_spac, induced with 1µM IPTG

We tested its expression by inserting gfp into the MCS downstream of P_spac and transforming the plasmid into B. subtilis W168. Two independent clones were induced with 0, 0.1 or 2 µM IPTG and checked for fluorescence under the microscope. The fluorescence intensity of at least 100 cells was measured with imageJ.

lacZ-activity in Miller units in pSBBs0K-Pspac depending on B. subtilis growth phase.

The vector is now IPTG-inducible, but high induction only leads to low and heterogenous gene expression.

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

Note from iGEM Toulouse 2016:

This plasmid is the only replicative plasmid for Bacillus subtilis in the registry. As so, this BioBrick was improved by the iGEM Toulouse 2016 team by reducing its size down to 5827pb (compared to the 9358pb of the entire pSBBsOK -P). This makes clonings a lot more convenient. This new version is available at https://parts.igem.org/Part:BBa_K1937001. It is also described at http://2016.igem.org/Team:Toulouse_France/Description

Note that iGEM Toulouse 2016 also improved this backbone by creating from it a part that could turn any pSB1C3-based plasmid in a E.coli/B.subtilis shuttle vector. This part is named OriKan and can be found at https://parts.igem.org/Part:BBa_K1937002. While Bacillus subtilis is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they are registered after sub-cloning in the E. coli plasmid pSB1C3. In this context, the OriKAn part opens the whole iGEM registry to Bacillus-based projects. Its construction and validation are presented at http://2016.igem.org/Team:Toulouse_France/Description.

Sequence and Features