Difference between revisions of "Part:BBa K1927000:Design"

Revision as of 07:10, 14 October 2016

Beta-lacatamase enzyme called blaNDM-1

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
INCOMPATIBLE WITH RFC[1000]
Illegal BsaI site found at 716

Design Notes

This particular gene belongs to class B which represent metallo-β-lacatamases that contain zink in the active site. We designed this biobrick without any promotor for safety reasons. As this enzyme may be resistant to several types of antibiotic the UiOslo team felt that it would be safer to design the biobrick without any promotor so that any team that wish to work with this part may use it in a controlled manner.

The sequence was obtained from a clinical isolate collected from Norway and was sent to IDT for synthesizing. By designing special flanking regions the gene could easily be cloned into the shipping vector by Gibson Assembly.

These are the flanking regions the gene was designed with: Gctaaggatgatttctggaattcgcggccgcttctagatg<GENE>tactagtagcggccgctgcagtccggcaaaaaagggcaag

Source

This part is originally from a clinical isolate of a ESBL E. Coli strain collected from a antibiotic resistance expertize center in Tromsø, Norway. The sequence has been sendt to IDT and synthesized.

References

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1932750/ http://www.sciencedirect.com/science/article/pii/S1319562X14000941#b0405

@@ Line 10: / Line 10: @@
 This particular gene belongs to class B which represent metallo-&#946;-lacatamases that contain zink in the active site.
-The mechanism of beta lactamases are oriented to the bacterial cell wall. This cell wall is
+We designed this biobrick without any promotor for safety reasons. As this enzyme may be resistant to several types of antibiotic the UiOslo team felt that it would be safer to design the biobrick without any promotor so that any team that wish to work with this part may use it in a controlled manner.
-unique to bacteria and consist of several components. Gram Positive and gram negative
-bacteria will have a different cell wall composition.
+The sequence was obtained from a clinical isolate collected from Norway and was sent to IDT for synthesizing. By designing special flanking regions the gene could easily be cloned into the shipping vector by Gibson Assembly.
-In general, Gram-positive bacteria have a thicker layer of cell wall as well as a layer of
-cytoplasmic membrane. These layers consist of several conserved compounds such as
+These are the flanking regions the gene was designed with:
-monomeric disaccharide tetrapeptide, which are usually also those that will trigger an
+Gctaaggatgatttctggaattcgcggccgcttctagatg<GENE>tactagtagcggccgctgcagtccggcaaaaaagggcaag
-immunological defence respons of the host.
-Gram-negative bacteria (e.g., Escherichia coli) typically contain an outer membrane, an
-intervening periplasmic space where a thin layer of cell wall resides, and a layer of
-cytoplasmic membrane.
-&#946;-lacatamases are usually produced both by gram negative and positive bacteria, either
-from plasmid or chromosomally. Beta lactamases are able to resist several types of
-antibiotics. These antibiotics all have in common a 4 - atom ring called beta lactam ring
-which the enzyme are able to hydrolyze and break open and the molecule looses its
-antibacterial function.
-Penicillin, a regulary used antibiotic have such a beta lactam ring.
-This drug was the first antibiotic to be discovered and is still widely used today. This ring will
-bind to an enzyme (DD –transpeptidase) that is in charge of renewing the bacterial cell wall.
-Without this enzyme there will be no new formations of peptidoglycans for the cell wall and
-the integrity of the bacterial cell wall will be lost, it will eventually rupture and the bacteria will
-die. By hydrolyzing the ring, it will make the molecule unable to bind to the cell wall
-producing enzyme, thus the Penicillin have lost its destructive activity.We designed this biobrick without any promotor so the part would be less dangerous to deal with.
 ===Source===