Difference between revisions of "Part:BBa K1875017"
Line 1: | Line 1: | ||
+ | __NOTOC__ | ||
+ | <partinfo>BBa_K1875017 short</partinfo> | ||
+ | Double Operator | ||
+ | |||
+ | The BostonU 2016 iGEM team’s Gemini Library contains analog parts in addition to their digital parts. They synthesized multimerized binding sites to increase the expression of the operator. This hypothesis was supported by analogous results in previous synthetic transcriptional regulator research. A multimerized operator means that there are consecutive operators upstream of the promoter where the dCas9-VPR and guide RNA will bind to. In addition to multimerizing operator sites, BostonU 2016 also modulated the space between the binding sites. The graph below demonstrates a screen with this multimerized operator containing the target for g13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the strongest of its double multimerized operators which had a 24 base pair spacer between the operators. | ||
+ | |||
+ | <!-- Add more about the biology of this part here | ||
+ | ===Usage and Biology=== | ||
+ | |||
+ | <!-- --> | ||
+ | <span class='h3bb'>Sequence and Features</span> | ||
+ | <partinfo>BBa_K1875017 SequenceAndFeatures</partinfo> | ||
+ | |||
+ | |||
+ | <!-- Uncomment this to enable Functional Parameter display | ||
+ | ===Functional Parameters=== | ||
+ | <partinfo>BBa_K1875017 parameters</partinfo> | ||
+ | <!-- --> |
Revision as of 18:18, 12 October 2016
This operator, when paired with a guide RNA, expresses GFP.
Double Operator
The BostonU 2016 iGEM team’s Gemini Library contains analog parts in addition to their digital parts. They synthesized multimerized binding sites to increase the expression of the operator. This hypothesis was supported by analogous results in previous synthetic transcriptional regulator research. A multimerized operator means that there are consecutive operators upstream of the promoter where the dCas9-VPR and guide RNA will bind to. In addition to multimerizing operator sites, BostonU 2016 also modulated the space between the binding sites. The graph below demonstrates a screen with this multimerized operator containing the target for g13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the strongest of its double multimerized operators which had a 24 base pair spacer between the operators.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 974
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]