Difference between revisions of "Part:BBa K1926002"

Revision as of 05:54, 11 October 2016

A cyclic promoter of Ki-67 from human genome

This part is a cyclic promoter of Ki67 from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[1].

1. Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66.

You may use this part to:

1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;

2) Use it as a human promoter by transient transfecting it into cells.

Source:

The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:

pKi67-F: ACCTCTGCCCTCCGCCAGCCG

pKi67-R: ACCCGGTGGCCCTACAGGCTACG

(Product: 360)

Promoter function confirmation

G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control.

Figure 1: in vivo testing pG1 promoter function in human 293 cell line.

Sequence and Features