Difference between revisions of "Part:BBa K1926001"
Line 33: | Line 33: | ||
G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control. | G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control. | ||
− | [[Image: | + | [[Image:T--SYSU-CHINA--result-img.jpeg|450px|thumb|left|'''Figure 1:''' in vivo testing pG1 promoter function in human 293 cell line.]] |
[https://static.igem.org/mediawiki/parts/1/17/T--SYSU-CHINA--result-img.jpeg here] | [https://static.igem.org/mediawiki/parts/1/17/T--SYSU-CHINA--result-img.jpeg here] | ||
Revision as of 05:22, 11 October 2016
A cyclic promoter of Cyclin E from human genome
This part is a cyclic promoter of protein Cyclin E from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[1,2]
1. Hwang, H.C. and B.E. Clurman, Cyclin E in normal and neoplastic cell cycles. Oncogene, 2005. 24(17): p. 2776-86.
2. Ohtani, K., J. DeGregori, and J.R. Nevins, Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12146-50.
You may use this part to:
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.
Source:
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
pCCNE-F: CGTGTTTACATTCCACCCGCGCCA
pCCNE-R: TGATGGGGCTGCTCCGGCCT
(Product: 986)
Promoter function confirmation
G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NotI site found at 382
Illegal NotI site found at 497 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 529
Illegal XhoI site found at 1050 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 273
Illegal NgoMIV site found at 313
Illegal NgoMIV site found at 491 - 1000COMPATIBLE WITH RFC[1000]