Difference between revisions of "Part:BBa K1926002"
Line 3: | Line 3: | ||
<partinfo>BBa_K1926002 short</partinfo> | <partinfo>BBa_K1926002 short</partinfo> | ||
− | This part is a cyclic promoter | + | This part is a cyclic promoter of Ki67 from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[3]. |
− | 3. Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66. | + | 3. Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66. |
− | You may use this part to: | + | |
+ | ===You may use this part to:=== | ||
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line; | 1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line; | ||
2) Use it as a human promoter by transient transfecting it into cells. | 2) Use it as a human promoter by transient transfecting it into cells. | ||
+ | |||
+ | |||
+ | ===Source:=== | ||
+ | |||
+ | The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers: | ||
+ | |||
+ | pCCNE-F: CGTGTTTACATTCCACCCGCGCCA | ||
+ | |||
+ | pCCNE-R: TGATGGGGCTGCTCCGGCCT | ||
+ | |||
+ | (Product: 986) | ||
+ | |||
+ | |||
+ | ===Promoter function confirmation=== | ||
+ | |||
+ | G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control. | ||
+ | |||
Revision as of 03:56, 11 October 2016
A cyclic promoter of Ki-67 from human genome
This part is a cyclic promoter of Ki67 from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[3].
3. Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66.
You may use this part to:
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.
Source:
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
pCCNE-F: CGTGTTTACATTCCACCCGCGCCA
pCCNE-R: TGATGGGGCTGCTCCGGCCT
(Product: 986)
Promoter function confirmation
G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 425
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 422