Difference between revisions of "Help:Terminators"
(→Poly-A tails) |
Smelissali (Talk | contribs) |
||
| Line 6: | Line 6: | ||
A terminator (short for "transcriptional terminator") is a stretch of DNA which halts the otherwise continuous process of transcription (making the RNA copy of a DNA sequence). | A terminator (short for "transcriptional terminator") is a stretch of DNA which halts the otherwise continuous process of transcription (making the RNA copy of a DNA sequence). | ||
| + | ==Assembly with terminators== | ||
| + | The hairpin structure created by the terminator sequence and its small sequence size make it quite difficult to remove this piece from a plasmid. It is much easier to leave the piece inside of its plasmid and ligate another brick ahead of or behind this one. | ||
==Stem-loop type terminators== | ==Stem-loop type terminators== | ||
Revision as of 21:36, 8 June 2007
Browse terminator parts!
A terminator (short for "transcriptional terminator") is a stretch of DNA which halts the otherwise continuous process of transcription (making the RNA copy of a DNA sequence).
Contents
Assembly with terminators
The hairpin structure created by the terminator sequence and its small sequence size make it quite difficult to remove this piece from a plasmid. It is much easier to leave the piece inside of its plasmid and ligate another brick ahead of or behind this one.
Stem-loop type terminators
In our prokaryotic BioBrick host cells these terminator parts are often palindromic (same sequence forwards and backwards on the two DNA strands) and the RNA transcript (the second half of which is the reverse complement of the first half) forms a stem-loop structure by folding back on itself. This structure then terminates transcription.
One example of a BioBrick which uses this method is the terminator Part:BBa_B0011, which has the sequence"aaaagccagattattaatccggctttt" on one DNA strand. The corresponding RNA transcript (with U's in place of T's) can fold back into a hairpin with the green nucleotides running right-to-left and the red left-to-right. (Try drawing out the base-paired structure -- the middle of the hairpin has three unpaired bases and the stem has one mismatch.)
PolyA tails
In eukaryotic hosts such as yeast, the signals for termination follow the coding regions of the genes. These signals can occur as many as 1000 nucleotides downstream of the final, functional transcripts. For protein-coding genes this untranslated region (called a 3'-UTR) gets cut at a specific site and a string of adenine ("A") nucleotides is added that serves to protect the transcript. A number of sequence features help to specify this location. One frequent component of this set of signals is the "polyA" motif "AAUAAA".
Rho type terminators
Another method which bacterial cells like E. coli use to terminate a sequence is through the action of the Rho protein.