Difference between revisions of "Part:BBa K2009820"
Line 4: Line 4:
 
<partinfo>BBa_K2009820 short</partinfo>
 
<partinfo>BBa_K2009820 short</partinfo>
  
−
<p style="font-weight:bold; font-size:40px;">introduction</p>
+
<p style="font-weight:bold; font-size:20px;">Sequence And Features</p>
 +
<partinfo>BBa_K2009820 SequenceAndFeatures</partinfo>
  
 +
<p style="font-weight:bold; font-size:20px;">introduction</p>
 +
<hr>
 
<p > </p>
 
<p > </p>
  
−
<html>
+
 
−
<a href="http://2016.igem.org"> sfgfp11</a>
+
−
<img src="https://static.igem.org/mediawiki/parts/c/c8/T--USTC--sfGFP1-10.png">
+
−
</html>
+
 
sfGFP11 length: 48bp
 
sfGFP11 length: 48bp
 +
<br>
 
Derived from:synthesis from Sangon
 
Derived from:synthesis from Sangon
  
 
sfGFP11——PSB1C3 is an expression plasmid which insert sfGFP11 into PSB1C3.
 
sfGFP11——PSB1C3 is an expression plasmid which insert sfGFP11 into PSB1C3.
−
<hr/>
 
 
before sfGFP11, we add a linker(gatggagggtctggtggcggatca) to achieve our goal.SfGFP11 is a part of GFP(from 214bp to 230bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.
 
before sfGFP11, we add a linker(gatggagggtctggtggcggatca) to achieve our goal.SfGFP11 is a part of GFP(from 214bp to 230bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.
  
Line 23: Line 23:
 
Usage and biology:The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste´phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)
 
Usage and biology:The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste´phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)
  
−
Part sequence
+
<p style="font-weight:bold; font-size:20px;">Part Sequence</p>
 +
<hr>
  
 
agagaccacatggtccttcatgagtatgtaaatgctgctgggattaca
 
agagaccacatggtccttcatgagtatgtaaatgctgctgggattaca
Line 32: Line 33:
  
 
<!-- -->   
 
<!-- -->   
−
<span class='h3bb'>Sequence and Features</span>
 
−
<partinfo>BBa_K2009820 SequenceAndFeatures</partinfo>
 
  
  

Revision as of 08:27, 15 September 2016


sfGFP11

Sequence And Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 26

introduction


sfGFP11 length: 48bp
Derived from:synthesis from Sangon

sfGFP11——PSB1C3 is an expression plasmid which insert sfGFP11 into PSB1C3. before sfGFP11, we add a linker(gatggagggtctggtggcggatca) to achieve our goal.SfGFP11 is a part of GFP(from 214bp to 230bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.

We try to find anideal protein tag to be work both invivo and invitro and it can provide a sensitive measurable signalwhich don’t need external chemical reagents or substrates. Finally we find away to accomplish this goal—— dividing GFP into sfGFP1-10and sfGFP11. Either the sfGFP1-10 or sfGFP11 will emit green fluorescence slightly under the fluorescencemicroscope. However, when sfGFP1-10 and sfGFP11 express insame cell, they will interact each other and emit more intense fluorescence thaneach of them. The split GFP system is simple and does not change fusion proteinsolubility.

Usage and biology:The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste´phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)

Part Sequence

agagaccacatggtccttcatgagtatgtaaatgctgctgggattaca (All the sequence has been testified by Sangon)