Difference between revisions of "Help:BioBrick Prefix and Suffix"

m (→‎BioBrick Suffix)
(Revert to simpler page)
Line 15: Line 15:
  
 
==BioBrick Prefix==
 
==BioBrick Prefix==
−
The standard BioBrick prefix depends on the part that follows it (<FONT COLOR="#BABABA">part in grey</FONT>, <FONT COLOR="#CC00FF">EcoRI</FONT>,<FONT COLOR="#FF5333"> XbaI</FONT>).  YOUR SEQUENCE as it should be entered into the database is in uppercase letters.
+
The standard BioBrick prefix depends on the part that follows it.
−
{|width='85%' style='border:1px solid gray; margin-left:2em'
+
{|width='80%' style='border:1px solid gray; margin-left:2em'
−
|width='45%'|
+
|width='50%'|
 
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:
 
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:
−
|width='55%' valign='top'|
+
|width='50%' valign='top'|
−
'''<span style='font-family:monospace;font-size:175%;padding-left:1em;'><FONT COLOR="#CC00FF">gaattc</FONT>gcggccgct<FONT COLOR="#FF5333">tctag</FONT><FONT COLOR="#BABABA">ATG...</FONT></span>'''
+
<div style='font-family:monospace;font-size:175%;padding-left:1em;'>gaattcgcggccgcttctag</div>
 
|-
 
|-
−
|width='45%'|
+
|width='50%'|
 
Otherwise, the BioBrick prefix is:
 
Otherwise, the BioBrick prefix is:
−
|width='55%'|
+
|width='50%'|
−
'''<span style='font-family:monospace;font-size:175%;padding-left:1em'><FONT COLOR="#CC00FF">gaattc</FONT>gcggccgct<FONT COLOR="#FF5333">tctaga</FONT>g<FONT COLOR="#BABABA">CA...</FONT></span>'''
+
<div style='font-family:monospace;font-size:175%;padding-left:1em'>gaattcgcggccgcttctagag</div>
 
|}
 
|}
 +
  
 
==BioBrick Suffix==
 
==BioBrick Suffix==
−
Similarly, the standard BioBrick suffix depends on the part that precedes it.  Whenever possible, the transcriptional start site of a promoter part should lie 2bp upstream of the SpeI site. (<FONT COLOR="#BABABA">part in grey</FONT>, <FONT COLOR="#CC00FF">PstI</FONT>,<FONT COLOR="#FF5333"> SpeI</FONT>).    YOUR SEQUENCE as it should be entered into the database is in uppercase letters.  For help locating the transcription initiation site in your promoter part, try [http://www.fruitfly.org/seq_tools/promoter.html promoter prediction.]
+
{|width='80%' style='border:1px solid gray; margin-left:2em'
−
{|width='85%' style='border:1px solid gray; margin-left:2em'
+
|width='50%'|
−
|width='45%'|
+
The standard BioBrick suffix is always:
−
The standard BioBrick suffix for most parts:
+
|width='50% 'valign='top'|
−
|width='55% 'valign='top'|
+
<div style='font-family:monospace;font-size:175%;padding-left:1em'>tactagtagcggccgctgcag</div>
−
'''<span style='font-family:monospace;font-size:175%;padding-left:1em'><FONT COLOR="#BABABA">...AC</FONT>t<FONT COLOR="#FF5333">actagt</FONT>agcggccg<FONT COLOR="#CC00FF">ctgcag</FONT></span>'''
+
−
|-
+
−
|width='45%'|
+
−
For promoter parts, the transcriptional initiation site (in green) is placed 2 bp upstream of the SpeI site:
+
−
|width='55%'|
+
−
'''<span style='font-family:monospace;font-size:175%;padding-left:1em'><FONT COLOR="#BABABA">...CA</FONT><FONT COLOR="#00FF7F">C</FONT>t<FONT COLOR="#FF5333">actagt</FONT>agcggccg<FONT COLOR="#CC00FF">ctgcag</FONT></span>'''
+
 
|}
 
|}
 +
  
 
==BioBrick Scar==
 
==BioBrick Scar==
Line 49: Line 45:
 
If the second part starts "AT", the scar is:
 
If the second part starts "AT", the scar is:
 
|width='50%' valign='top'|
 
|width='50%' valign='top'|
−
<span style='font-family:monospace;font-size:175%;padding-left:1em;'>tactag</span>
+
<div style='font-family:monospace;font-size:175%;padding-left:1em;'>tactag</div>
 
|-
 
|-
 
|width='50%'|
 
|width='50%'|
 
Otherwise, the scar is:
 
Otherwise, the scar is:
 
|width='50%'|
 
|width='50%'|
−
<span style='font-family:monospace;font-size:175%;padding-left:1em'>tactagag</span>
+
<div style='font-family:monospace;font-size:175%;padding-left:1em'>tactagag</div>
 
|}
 
|}
  

Revision as of 19:32, 25 May 2007

Partinps.png

For more information about how the prefix and suffix were determined and the special case of coding regions, see Assembly:RBS-CDS_issues.

Part Sequence

The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include any bases of the BioBrick Prefix or Suffix.

Plasmids (see below) and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.


BioBrick Prefix

The standard BioBrick prefix depends on the part that follows it.

If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:

gaattcgcggccgcttctag

Otherwise, the BioBrick prefix is:

gaattcgcggccgcttctagag


BioBrick Suffix

The standard BioBrick suffix is always:

tactagtagcggccgctgcag


BioBrick Scar

When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts.

If the second part starts "AT", the scar is:

tactag

Otherwise, the scar is:

tactagag


Plasmid Sequences

Since plasmids are circular pieces of DNA, the specification of the "first" base is arbitrary. Furthermore, plasmids often hold BioBrick parts, leading to a question of how the plasmid itself is defined.

In the Registry, we define the plasmid as starting with the first base of the suffix and ending with the last base of the BioBrick prefix. That definition keeps the plasmid continuous and breaks it where parts will be inserted.