Difference between revisions of "Part:BBa K1777000"
(→Function) |
|||
Line 21: | Line 21: | ||
'''Figure 1. Validation of the psiCHECKTM2-miR21 binding plasmid.'''<br> | '''Figure 1. Validation of the psiCHECKTM2-miR21 binding plasmid.'''<br> | ||
HEK-293T cells, Hela cells and U87 cells were seeded into a 24-well plate. MiR21 binding sites was subcloned into the psiCHECKTM-2 Vector using the XhoI and PmeI restriction sites. Twenty hours post- transfection, Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System (Cat.# E1980; 21). The Renilla luciferase data has been normalized to firefly luciferase data, each experiment has three or five replicates. The data indicate in miR21 overexpressed cells (Hela and U87), miR21 binding sites are binded with miR21, inhibiting the Renilla luciferase while in control cells (HEK 293T), the Renilla luciferase is at normal level. | HEK-293T cells, Hela cells and U87 cells were seeded into a 24-well plate. MiR21 binding sites was subcloned into the psiCHECKTM-2 Vector using the XhoI and PmeI restriction sites. Twenty hours post- transfection, Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System (Cat.# E1980; 21). The Renilla luciferase data has been normalized to firefly luciferase data, each experiment has three or five replicates. The data indicate in miR21 overexpressed cells (Hela and U87), miR21 binding sites are binded with miR21, inhibiting the Renilla luciferase while in control cells (HEK 293T), the Renilla luciferase is at normal level. | ||
+ | ===As a tool=== | ||
+ | Since the binding sites can bind miR21 significantly, we use it as a tool to detect whether our sponge can knock down the level of miR21 in vivo. we cotransfected pSICHECK2-miR21 binding plasmid and pCDH-linear mir21 sponge(see [http://https://parts.igem.org/Part:BBa_K1777003])in Hela cells. Forty-eight hours post-transfection,Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System. It proves that our pCDH-linear mir21 sponge knocks down the level of miR21.<br> | ||
+ | [[File:cotransfection hela.jpg]] |
Revision as of 09:21, 20 September 2015
two mir-21 binding sites
This part is composite of two mir-21 binding sites in the 3'-UTR. With this modification in the 3'-UTR, this luciferase can be inserted into 3'UTR and make the luciferase to serve as a reporter of mir-21. If this part is expressed in a cell with high level expression of mir-21, it will report a decreased Renilla luciferase activity.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
TCGAGTCAACATCAGGACATAAGCTAGTTTTACTAGAGTCGAGTCAACATCAGGACATAAGCTAGTTT
Function
Two miR-21 binding sites can bind miR-21 so that the Renilla Luciferase is reduced in miR21 overexpressed cells (Hela, U87 cell lines) compared with the normal cell line(HEK 293T)
Figure 1. Validation of the psiCHECKTM2-miR21 binding plasmid.
HEK-293T cells, Hela cells and U87 cells were seeded into a 24-well plate. MiR21 binding sites was subcloned into the psiCHECKTM-2 Vector using the XhoI and PmeI restriction sites. Twenty hours post- transfection, Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System (Cat.# E1980; 21). The Renilla luciferase data has been normalized to firefly luciferase data, each experiment has three or five replicates. The data indicate in miR21 overexpressed cells (Hela and U87), miR21 binding sites are binded with miR21, inhibiting the Renilla luciferase while in control cells (HEK 293T), the Renilla luciferase is at normal level.
As a tool
Since the binding sites can bind miR21 significantly, we use it as a tool to detect whether our sponge can knock down the level of miR21 in vivo. we cotransfected pSICHECK2-miR21 binding plasmid and pCDH-linear mir21 sponge(see [http://https://parts.igem.org/Part:BBa_K1777003])in Hela cells. Forty-eight hours post-transfection,Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System. It proves that our pCDH-linear mir21 sponge knocks down the level of miR21.