Difference between revisions of "Part:BBa K1725301"
 
Line 152: Line 152:
  
 
==Obtaining parts==
 
==Obtaining parts==
−
RBS library parts are not submitted to the registry. For obtaining physical DNA of a particular RBS sequence or of the whole RBS library we offer de novo synthesis by PCR.<br>
+
RBS library parts were not submitted as DNA to the registry. For obtaining physical DNA of a particular RBS sequence or of the whole RBS library we suggest incorporating the RBS library into your forward PCR primer as described below.<br>
 
Primer sequence for obtaining RBS library for a specific gene:  
 
Primer sequence for obtaining RBS library for a specific gene:  
 
<br>
 
<br>
−
aaataa<font color="blue">GAATTCGCGGCCGCTTCTAGAG</font><font color="red">TCACACANRARRG</font><font color="green">TACTAG</font>ATG  
+
aaataa<font color="blue">GAATTCGCGGCCGCTTCTAGAG</font><font color="red">TCACACANRARRG</font><font color="green">TACTAG</font>ATG ...
 
<br>
 
<br>
−
random sequence--<font color="blue">biobrick prefix</font>--<font color="red">RBS degenerate sequence</font>--<font color="green">RBS scar</font>--start codon
+
5' extension for improved EcoRI cleavage--<font color="blue">biobrick prefix</font>--<font color="red">RBS degenerate sequence</font>--<font color="green">RBS scar</font>--start codon
 
<br>
 
<br>
−
After the ATG, oligo should contain 18-24 nucleotides, complementary to the open reading frame being amplified. PCR is then performed as described in the [http://2015.igem.org/Team:Glasgow/Project/Overview/Protocols Protocols].
+
After the ATG, the oligo should contain 18-24 nucleotides, complementary to the open reading frame being amplified. PCR can then be performed as described in the [http://2015.igem.org/Team:Glasgow/Project/Overview/Protocols Protocols].
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Latest revision as of 20:51, 19 September 2015

Member of the RBS library - derived from BBa_B0032

Parts K1725301-K1725332 are members of ribosome binding site library derived from Anderson-family RBS BBa_B0032. All 32 sequences were obtained by randomised PCR.

Design

For the construction of the RBS library, a master sequence based on the RBS B0032 was used. 4 nucleotides within the actual ribosome binding site were randomised giving 32 different B0032-derived RBS variants. The predicted efficiency of each RBS library member was estimated using RBS Library Calculator. Originally, RBS Library was designed for every gene in luxABGCDE operon (BBa_K1725352) in order to optimise bioluminescence in E. coli. 32 different BioBrick RBS variants were incorporated upstream of each of the lux genes by PCR, and different libraries were then combined together by BioBrick assembly. This method could potentially produce over 1 billion different variants of the lux operon. The developed method was relatively quick, and could easily be used to optimize other metabolic pathways where a suitable screen or selection for optimal performance is available.

Different variants of the lux operon in E. coli
Design of the RBS library for the lux operon

B0032-derived RBS library members

Estimated strengths of RBS library members for luxA gene; from left to right: K1725332 - K1725301
Identifier Sequence Estimated strength (au)
Degenerate sequence TCACACANRARRG -
BBa_K1725301 TCACACAGGAGGG 15730.86
BBa_K1725302 TCACACAGGAGAG 12493.41
BBa_K1725303 TCACACAGGAAGG 8716.05
BBa_K1725304 TCACACAAGAGGG 7247.43
BBa_K1725305 TCACACAAGAAGG 5532.39
BBa_K1725306 TCACACACGAGGG 3880.58
BBa_K1725307 TCACACATGAGGG 3880.58
BBa_K1725308 TCACACAAAAAGG 2574.21
BBa_K1725309 TCACACAAAAGGG 2574.21
BBa_K1725310 TCACACACAAAGG 2574.21
BBa_K1725311 TCACACACAAGGG 2574.21
BBa_K1725312 TCACACAGAAAGG 2574.21
BBa_K1725313 TCACACATAAAGG 2574.21
BBa_K1725314 TCACACATAAGGG 2574.21
BBa_K1725315 TCACACATGAAGG 2574.21
BBa_K1725316 TCACACACGAAGG 2352.63
BBa_K1725317 TCACACAGGAAAG 2161.77
BBa_K1725318 TCACACAAGAGAG 1969.19
BBa_K1725319 TCACACATGAGAG 1506.8
BBa_K1725320 TCACACACGAGAG 1500.04
BBa_K1725321 TCACACAGAAGGG 1203.18
BBa_K1725322 TCACACAAAAGAG 875.94
BBa_K1725323 TCACACACAAGAG 875.94
BBa_K1725324 TCACACAGAAGAG 875.94
BBa_K1725325 TCACACATAAGAG 875.94
BBa_K1725326 TCACACAAGAAAG 355.35
BBa_K1725327 TCACACAAAAAAG 271.26
BBa_K1725328 TCACACACAAAAG 271.26
BBa_K1725329 TCACACAGAAAAG 271.26
BBa_K1725330 TCACACATAAAAG 271.26
BBa_K1725331 TCACACATGAAAG 271.26
BBa_K1725332 TCACACACGAAAG 158.07

Randomised sequence locations are shown in red. Estimated strength corresponds to the Translation Initiation Rate values predicted by RBS library calculatorfor luxA gene.

Obtaining parts

RBS library parts were not submitted as DNA to the registry. For obtaining physical DNA of a particular RBS sequence or of the whole RBS library we suggest incorporating the RBS library into your forward PCR primer as described below.
Primer sequence for obtaining RBS library for a specific gene:
aaataaGAATTCGCGGCCGCTTCTAGAGTCACACANRARRGTACTAGATG ...
5' extension for improved EcoRI cleavage--biobrick prefix--RBS degenerate sequence--RBS scar--start codon
After the ATG, the oligo should contain 18-24 nucleotides, complementary to the open reading frame being amplified. PCR can then be performed as described in the [http://2015.igem.org/Team:Glasgow/Project/Overview/Protocols Protocols].

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]