Difference between revisions of "Part:BBa K1758320:Design"
| Line 1: | Line 1: | ||
===Design Notes=== | ===Design Notes=== | ||
<html> | <html> | ||
| − | We used the codon optimized, synthesized Sequence of cueR from <i> E.coli </i> under the control of a constitutive Primer (BBa:K608002). We designed the used primes, in specially split primers, for Gibson Assembly to ligate the constitutive Promoter and cueR with pSB1C3. For this aim we designed four primers for the generation of homologous overlaps between the synthesized constitutive promoter+ cueR and the pSB1C3: | + | We used the codon optimized, synthesized Sequence of <i>cueR</i> from <i> E.coli </i> under the control of a constitutive Primer (BBa:K608002). We designed the used primes, in specially split primers, for Gibson Assembly to ligate the constitutive Promoter and <i>cueR</i> with pSB1C3. For this aim we designed four primers for the generation of homologous overlaps between the synthesized constitutive promoter+ <i>cueR</i> and the pSB1C3: |
<p><a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#cm_rev" target="_blank"> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#cm_rev" target="_blank">cm_rev</a> </p> <p>TATACGCAAGGCGACAAG</p> | <p><a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#cm_rev" target="_blank"> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#cm_rev" target="_blank">cm_rev</a> </p> <p>TATACGCAAGGCGACAAG</p> | ||
<p><a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers# pSB1C3_kPrm_fwd" target="_blank"> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers# pSB1C3_kPrm_fwd " target="_blank"> pSB1C3_kPrm_fwd</a> </p> <p>CTAGGACTGAGCTAGCTGTCAATACTAGTAGCGGCCGCTGCA </p> | <p><a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers# pSB1C3_kPrm_fwd" target="_blank"> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers# pSB1C3_kPrm_fwd " target="_blank"> pSB1C3_kPrm_fwd</a> </p> <p>CTAGGACTGAGCTAGCTGTCAATACTAGTAGCGGCCGCTGCA </p> | ||
Latest revision as of 03:06, 19 September 2015
Design Notes
We used the codon optimized, synthesized Sequence of cueR from E.coli under the control of a constitutive Primer (BBa:K608002). We designed the used primes, in specially split primers, for Gibson Assembly to ligate the constitutive Promoter and cueR with pSB1C3. For this aim we designed four primers for the generation of homologous overlaps between the synthesized constitutive promoter+ cueR and the pSB1C3:
TATACGCAAGGCGACAAG
CTAGGACTGAGCTAGCTGTCAATACTAGTAGCGGCCGCTGCA
GGTTGTTGTCATCATCGCGCAGGGTAACTCTAGAAGCGGCCGCGAAT
CGGCATCAGCACCTTGTC
Source
Synthesized, codon optimized gene of E. coli Synthesized by IDT
References
Synthesized by IDT