Difference between revisions of "Part:BBa K1728019"
| Line 1: | Line 1: | ||
| − | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K1728019 short</partinfo> | <partinfo>BBa_K1728019 short</partinfo> | ||
| Line 5: | Line 4: | ||
SAT toehold switch RNA sensor with T7 promoter & luciferase reporter | SAT toehold switch RNA sensor with T7 promoter & luciferase reporter | ||
| − | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
| + | Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(GCACCTAACCGTTCAATAACATAGAACTCC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Signal Transducer and Activator of Transcription (SAT) mRNA(SAT partial sequence, BBa_K1728007). Once the SAT mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene. In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(SAT toehold switch RNA sensor, BBa_K1728003). This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter. | ||
<!-- --> | <!-- --> | ||
Revision as of 23:09, 18 September 2015
SAT toehold switch RNA sensor with T7 promoter & luciferase reporter
SAT toehold switch RNA sensor with T7 promoter & luciferase reporter
Usage and Biology
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(GCACCTAACCGTTCAATAACATAGAACTCC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Signal Transducer and Activator of Transcription (SAT) mRNA(SAT partial sequence, BBa_K1728007). Once the SAT mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene. In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(SAT toehold switch RNA sensor, BBa_K1728003). This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 922