Difference between revisions of "Part:BBa K1728008"

Line 6: Line 6:
 
===Usage and Biology===
 
===Usage and Biology===
 
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch.   
 
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch.   
 +
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>

Revision as of 21:55, 18 September 2015

IL8 toehold switch RNA sensor with T7 promoter

IL8 toehold switch RNA sensor with T7 promoter

Usage and Biology

Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]