Difference between revisions of "Part:BBa K1728002"
Line 7: | Line 7: | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(AAATAAATTGAAGTGGGCTCAAGGAGACCC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Dual specificity protein phosphatase 1 (DUSP1) mRNA(DUSP1 partial sequence, BBa_K1728006). Once the DUSP1 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene. | Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(AAATAAATTGAAGTGGGCTCAAGGAGACCC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Dual specificity protein phosphatase 1 (DUSP1) mRNA(DUSP1 partial sequence, BBa_K1728006). Once the DUSP1 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene. | ||
+ | |||
<!-- --> | <!-- --> | ||
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> |
Revision as of 19:39, 18 September 2015
DUSP1 toehold switch RNA sensor
DUSP1 toehold switch RNA sensor
Usage and Biology
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(AAATAAATTGAAGTGGGCTCAAGGAGACCC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Dual specificity protein phosphatase 1 (DUSP1) mRNA(DUSP1 partial sequence, BBa_K1728006). Once the DUSP1 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 24