Difference between revisions of "Part:BBa K1728001"

Revision as of 19:07, 18 September 2015

IL1β toehold switch RNA sensor

Sequence and Features

Assembly Compatibility:

@@ Line 1: / Line 1: @@
 __NOTOC__
 <partinfo>BBa_K1728001 short</partinfo>
@@ Line 7: / Line 6: @@
 <!-- Add more about the biology of this part here
 ===Usage and Biology===
+Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene
 <!-- -->
 <span class='h3bb'>Sequence and Features</span>