Difference between revisions of "Part:BBa K515000"
RebekkaBauer (Talk | contribs) |
Qiuxinyuan12 (Talk | contribs) |
||
Line 24: | Line 24: | ||
<h2>References</h2> | <h2>References</h2> | ||
<p>[1]Spaepen S. et al., 2007. Indole-3-acetic acid in microbial and microorganism-plant signaling. <i>Federation of European Microbiological Societies Microbiology Reviews </i>, 31, pp.425–448 </p> | <p>[1]Spaepen S. et al., 2007. Indole-3-acetic acid in microbial and microorganism-plant signaling. <i>Federation of European Microbiological Societies Microbiology Reviews </i>, 31, pp.425–448 </p> | ||
+ | |||
+ | |||
+ | |||
+ | ==Contribution: NUDT_CHINA 2015== | ||
+ | Author: Xinyuan Qiu | ||
+ | |||
+ | Summary: We built a new part based on this part to extend its function. | ||
+ | |||
+ | We designed a new part by removing the RBS from this part to extend its usage. | ||
+ | |||
+ | ====A new Bio-brick was designed based on this part==== | ||
+ | |||
+ | Primers used to build the new part: | ||
+ | |||
+ | F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGTTTGGACCGG-3’ | ||
+ | |||
+ | R-Prime: 5’- GCGGCGGACTAGTCTTATTAGTCCCCCAGCG -3’ | ||
+ | |||
+ | |||
+ | For further information, | ||
+ | |||
+ | See BBa_K1789000 | ||
+ | |||
+ | This part was sent to the registry. |
Revision as of 16:34, 18 September 2015
IaaM - tryptophan-2-mono-oxygenase IAA tryptophan monooxygenase (IaaM) catalyzes the oxidative carboxylation of L-tryptophan to indole-3-acetamide which acts as an intermediate to the production of indole-3-acetic acid in the IAM pathway. This auxin producing pathway originates from the plant pathogen, Pseudomonas savastanoi
This is one of the parts of our composite auxin expressing construct, BBa_K515100.
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 450
Illegal BamHI site found at 1395 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 157
- 1000COMPATIBLE WITH RFC[1000]
This BioBrick has been sequence verified.
For the full characterisation of the device, please refer to the BBa_K515100 page.
References
[1]Spaepen S. et al., 2007. Indole-3-acetic acid in microbial and microorganism-plant signaling. Federation of European Microbiological Societies Microbiology Reviews , 31, pp.425–448
==Contribution: NUDT_CHINA 2015== Author: Xinyuan Qiu Summary: We built a new part based on this part to extend its function. We designed a new part by removing the RBS from this part to extend its usage. ====A new Bio-brick was designed based on this part==== Primers used to build the new part: F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGTTTGGACCGG-3’ R-Prime: 5’- GCGGCGGACTAGTCTTATTAGTCCCCCAGCG -3’ For further information, See BBa_K1789000 This part was sent to the registry.