Difference between revisions of "Part:BBa K1586000"

Revision as of 15:20, 18 September 2015

Synthetic toehold riboswitch - J23100

Usage and Biology

A toehold switch is a type of RNA molecule known as a riboregulator/riboswitch. It is able to detect the presence of a specific ssRNA molecule (termed the 'trigger RNA') which has a sequence complementary to its switch region through base pairing. If the correct RNA molecule is detected, the protein coding region attached to the toehold switch is expressed.

A toehold switch is unique compared to other types of riboswitches as it is completely synthetic, and therefore easier to engineer and standardise. The fact that the toehold switch can be modified means that the switch region can be changed to detect any given trigger RNA molecule, and the protein coding region can be swapped for any desired reporter protein for easy measurement/visualisation.

Toehold switches can be used to detect specific RNA molecules in a cell-free system, or transformed into cells in order to ascertain whether a gene is being expressed (through detection of its mRNA). The applications of this technology can range from a research tool (e.g. detection of secreted RNA in cell supernatant, detection of gene expression, etc.), through to more commercial/medical applications such as diagnostic testing.

The Part

Part K1586000 encodes for a toehold switch forward engineered by Green et al. (2014), nicknamed GreenFET1 (Green forward engineered toehold). GreenFET1 is designed to detect a synthetic RNA trigger (GGGACUGACUAUUCUGUGCAAUAGUCAGUAAAGCAGGGAUAAACGAGAUAGAUAAGAUAAGAUAG) and produces GFP when activated. It contains non-standard ribosome binding site (RBS) and GFP reporter protein and has an intended use as a control/comparison toehold. For characterisation and use, GreenFET1 has been put under the control of a J23100 promoter. It can also be found under the control of a T7 promoter as part BBa_K1586001.

Characterisation

In order to characterise that this part works as expected, we measured fluorescence intensity of the expression of K1586000 in a cell free system in the presence of different amounts of trigger RNA. Shown below is a graph showing a positive correlation between amount of trigger RNA and GFP fluorescence intensity.

Sequence and Features

Functional Parameters