Difference between revisions of "Part:BBa K1586001"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1586001 short</partinfo>
 
<partinfo>BBa_K1586001 short</partinfo>
  
 +
===Usage and Biology===
 
A toehold switch is a type of RNA molecule known as a riboregulator/riboswitch. It is able to detect the presence of a specific ssRNA molecule (termed the 'trigger RNA') which has a sequence complementary to its switch region through base pairing. If the correct RNA molecule is detected, the protein coding region attached to the toehold switch is expressed.
 
A toehold switch is a type of RNA molecule known as a riboregulator/riboswitch. It is able to detect the presence of a specific ssRNA molecule (termed the 'trigger RNA') which has a sequence complementary to its switch region through base pairing. If the correct RNA molecule is detected, the protein coding region attached to the toehold switch is expressed.
−
A toehold switch is unique from other types of riboswitches as it is completely synthetic, and therefore easier to engineer and standardise. The fact that the toehold switch can be modified means that the switch region can be changed to detect any given trigger RNA molecule, and the protein coding region can be swapped for any desired reporter protein for easy measurement/visualisation.
+
 
 +
A toehold switch is unique compared to other types of riboswitches as it is completely synthetic, and therefore easier to engineer and standardise. The fact that the toehold switch can be modified means that the switch region can be changed to detect any given trigger RNA molecule, and the protein coding region can be swapped for any desired reporter protein for easy measurement/visualisation.
 +
 
 
Toehold switches can be used to detect specific RNA molecules in a cell-free system, or transformed into cells in order to ascertain whether a gene is being expressed (through detection of its mRNA). The applications of this technology can range from a research tool (e.g. detection of secreted RNA in cell supernatant, detection of gene expression, etc.), through to more commercial/medical applications such as diagnostic testing.
 
Toehold switches can be used to detect specific RNA molecules in a cell-free system, or transformed into cells in order to ascertain whether a gene is being expressed (through detection of its mRNA). The applications of this technology can range from a research tool (e.g. detection of secreted RNA in cell supernatant, detection of gene expression, etc.), through to more commercial/medical applications such as diagnostic testing.
−
Part K1586000 encodes for a toehold switch forward engineered by Green et al. (2014). This toehold switch is under the control of a J23100 promoter and contains a double terminator. It is designed to detect a synthetic RNA trigger (GGGACUGACUAUUCUGUGCAAUAGUCAGUAAAGCAGGGAUAAACGAGAUAGAUAAGAUAAGAUAG) and produces GFP when activated. This toehold switch contains non-standard ribosome binding site (RBS) and GFP reporter protein and has an intended use as a control. Part K1586003 encodes a more standardised toehold switch.
 
  
−
<!-- Add more about the biology of this part here
+
===The Part===
−
===Usage and Biology===
+
 
 +
Part K1586001 encodes for a toehold switch forward engineered by Green et al. (2014), nicknamed GreenFET1 (Green forward engineered toehold). GreenFET1 is designed to detect a synthetic RNA trigger (GGGACUGACUAUUCUGUGCAAUAGUCAGUAAAGCAGGGAUAAACGAGAUAGAUAAGAUAAGAUAG) and produces GFP when activated. It contains non-standard ribosome binding site (RBS) and GFP reporter protein and has an intended use as a control/comparison toehold. For characterisation and use, GreenFET1 has been put under the control of a T7 promoter. It can also be found under the control of a J23100 promoter as part <partinfo>K1586000</partinfo>.
  
 
<!-- -->
 
<!-- -->

Revision as of 10:21, 17 September 2015

Synthetic toehold riboswitch - T7

Usage and Biology

A toehold switch is a type of RNA molecule known as a riboregulator/riboswitch. It is able to detect the presence of a specific ssRNA molecule (termed the 'trigger RNA') which has a sequence complementary to its switch region through base pairing. If the correct RNA molecule is detected, the protein coding region attached to the toehold switch is expressed.

A toehold switch is unique compared to other types of riboswitches as it is completely synthetic, and therefore easier to engineer and standardise. The fact that the toehold switch can be modified means that the switch region can be changed to detect any given trigger RNA molecule, and the protein coding region can be swapped for any desired reporter protein for easy measurement/visualisation.

Toehold switches can be used to detect specific RNA molecules in a cell-free system, or transformed into cells in order to ascertain whether a gene is being expressed (through detection of its mRNA). The applications of this technology can range from a research tool (e.g. detection of secreted RNA in cell supernatant, detection of gene expression, etc.), through to more commercial/medical applications such as diagnostic testing.

The Part

Part K1586001 encodes for a toehold switch forward engineered by Green et al. (2014), nicknamed GreenFET1 (Green forward engineered toehold). GreenFET1 is designed to detect a synthetic RNA trigger (GGGACUGACUAUUCUGUGCAAUAGUCAGUAAAGCAGGGAUAAACGAGAUAGAUAAGAUAAGAUAG) and produces GFP when activated. It contains non-standard ribosome binding site (RBS) and GFP reporter protein and has an intended use as a control/comparison toehold. For characterisation and use, GreenFET1 has been put under the control of a T7 promoter. It can also be found under the control of a J23100 promoter as part BBa_K1586000.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 751