Difference between revisions of "Part:BBa K1668003:Design"
(→Design Notes) |
|||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K1668003 short</partinfo> | <partinfo>BBa_K1668003 short</partinfo> | ||
Line 23: | Line 22: | ||
<h4>Plasmid map</h4> | <h4>Plasmid map</h4> | ||
− | [[File: | + | [[File:-orfX-map.png|300px|thumb|left|Fig.3 the plasmid map of BBa_K1668003]] |
<br> | <br> | ||
<br> | <br> |
Revision as of 12:03, 15 September 2015
orfX (from Streptomyces avermitilis, increasing avermectin production)
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NotI site found at 160
Illegal NotI site found at 247
Illegal NotI site found at 361
Illegal NotI site found at 595
Illegal NotI site found at 745 - 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 510
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 463
Illegal AgeI site found at 264 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 441
Illegal BsaI.rc site found at 195
Design Notes
PCR
The orfX gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain. By PCR with primers orfX1 and orfX2 shown below, we added the standard prefix and suffix at both ends of the metK sequence.
Seamless assembly
We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol. By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
orfX1 (F, 5’-3’): GAATTCGCGGCCGCTTCTAGATGGTGAGCGCCT
orfX2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATTATTATCTGCGGTCC
Transformation and confirmation
After seamless assembly, standard plasmid pSB1C3 containing orfX gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers. The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.
Plasmid map
Source
The orfX gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain.
References
Hwang, Y. S., et al. (2003). "Cloning and Analysis of a DNA Fragment Stimulating Avermectin Production in Various Streptomyces avermitilis Strains." Appl Environ Microbiol 69(2): 1263-1269.