Difference between revisions of "Part:BBa K1773003"

Line 26: Line 26:
  
 
These restriction sites were mutated to make this gene biobrick compatible. Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit.
 
These restriction sites were mutated to make this gene biobrick compatible. Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit.
These mutagenic primers were used:
 
  
EcoRI mutagenesis :
 
Fw: cgttttcaatggcagaatccggcatttgatttggca
 
Rev: tgccaaatcaaatgccggattctgccattgaaaacg
 
 
XbaI Mutagenesis:
 
Fw: cgatcatcattattcttctctggatgctgatgttaatttggg
 
Rev: cccaaattaacatcagcatccagagaagaataatgatgatcg
 
 
PstI Mutagenesis:
 
Fw: gaagactgaactgcctgcggttaaacaacataaac
 
Rev: gtttatgttgtttaaccgcaggcagttcagtcttc
 
 
   
 
   
 
First multiple mutagenesis attempt was not fully successful, because restriction analysis (Figure 2.) of mutated plasmids showed, that only two out of three restriction sites were mutated.
 
First multiple mutagenesis attempt was not fully successful, because restriction analysis (Figure 2.) of mutated plasmids showed, that only two out of three restriction sites were mutated.

Revision as of 15:47, 9 September 2015

I-F type CRISPR-Cas Cas3 gene

I-F type CRISPR-Cas system Cas3 gene. This Cas3 gene has mutated EcoRI, XbaI, PstI sites for it to be biobrick compatible.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 2623
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 1344
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Unknown
  • 1000
    COMPATIBLE WITH RFC[1000]

Usage and Biology

This protein is one of the core components of I-type CRISPR-Cas DNA interference. DNA degradation starts when another ribonucleoprotein complex named Cascade (BBa_K1773005) finds the target DNA and begins to bond to the complementary strand of the DNA with its crRNA molecule. Then Cas3 is recruited, which targets the non-complementary ssDNA and uses its helicase-nuclease activity to degrade the DNA in a 3'-5' direction.

Altough CRISPR-Cas system is a bacterial and archeal defence mechanism against exogenous nucleic acids ,CRISPR-Cas systems have recently boomed in the scientific community as equipment to produce double strand brakes in any desirable place, and that way has a huge impact on cloning procedures. Type I CRISPR-Cas systems do not share a part of the fame, that Cas9 has (type 2 system). Mainly due to the fact, that in this type of systems there are more genes. Also I-type CRISPR-Cas systems cannot be used for molecular cloning, because they do not produce double strand DNA brakes, but rather hidrolyses big ammounts of DNA. This is iddeal for making a novel kill-switch-like system.


Quick change mutagenesis

The Wild type Cas3 gene has been cloned in Institute of Biotechnology and has unwanted EcoRI, XbaI and PstI restriction sites inside the gene.


(Figure1. Wild type Cas3 plasmid map. There are two restriction sites for each restriction enzyme all in close proximity. )


These restriction sites were mutated to make this gene biobrick compatible. Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit.


First multiple mutagenesis attempt was not fully successful, because restriction analysis (Figure 2.) of mutated plasmids showed, that only two out of three restriction sites were mutated.


(Figure 2. First restriction analysis. Restriction with EcoRI (E), XbaI (X) and PstI (P) of Wild type (WT) Cas3 gene compared to mutated Cas3 genes. The first mutant plasmid has two successful mutations, whereas the second mutant plasmid only has one successfully mutated restriction site.)


Later we mutagenised the Mutant#1 plasmid, for the third PstI restriction using the same procedure as before. After plasmid restriction analysis (Figure 3) we had many successfully mutated plasmid (all except mutated plasmid #1), which later were sequenced and confirmed.


(Figure 3. Restriction analysis of Cas3 mutagenesis second run. K - undigested Wild type Cas3 plasmid. E - digested with EcoRI; X - digested with XbaI; P - digested with PstI.)