Difference between revisions of "Part:BBa K1773003:Design"
(→Design Notes) |
|||
Line 6: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
− | + | Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit. | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
These mutagenic primers were used: | These mutagenic primers were used: | ||
Line 26: | Line 20: | ||
Fw: gaagactgaactgcctgcggttaaacaacataaac | Fw: gaagactgaactgcctgcggttaaacaacataaac | ||
Rev: gtttatgttgtttaaccgcaggcagttcagtcttc | Rev: gtttatgttgtttaaccgcaggcagttcagtcttc | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− |
Revision as of 15:46, 9 September 2015
I-F type CRISPR-Cas Cas3 gene
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 2623
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1344
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 2307
Illegal AgeI site found at 2680 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit.
These mutagenic primers were used:
EcoRI mutagenesis : Fw: cgttttcaatggcagaatccggcatttgatttggca Rev: tgccaaatcaaatgccggattctgccattgaaaacg
XbaI Mutagenesis: Fw: cgatcatcattattcttctctggatgctgatgttaatttggg Rev: cccaaattaacatcagcatccagagaagaataatgatgatcg
PstI Mutagenesis: Fw: gaagactgaactgcctgcggttaaacaacataaac Rev: gtttatgttgtttaaccgcaggcagttcagtcttc