Difference between revisions of "Part:BBa K1620000"

 
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1620000 short</partinfo>
 
<partinfo>BBa_K1620000 short</partinfo>
 
The universal stress protein A is a response of Escherichia coli cells to growth arrest, and its lacking generates cells with defective growth.This genetic element is dependent to sigma-70 factor. Its regulation is done through the concentration of a specific stationary phase allormone, guanosine-5'-diphosphate-3'-diphosphate (ppGp), as described elsewhere. The ppGp activate the transcription of downstream elements through a positive regulation of the &#946;-subunit of RNA polymerase. In this sense, the PuspA element is considered a stationary phase promoter. However, its behavior is like a constitutive transcription promotion, becoming higher in stress situations. Diverse conditions make the Escherichia coli cell enter to stress state, like heat shocks, starvation, osmotic stress, ultraviolet light and other conditions. In these situations, the RNA polimerase sigma factors (ropS) trigger the expression of chaperones and other stress protector molecules, in order to help the cell survive. In our project we have used this promoter to trigger the expression of limonene synthase after an osmotic shock. Other uses of this part includes the environmental stress detectors making using a reporter system coupled to this promoter.
 
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
  
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K1620000 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1620000 SequenceAndFeatures</partinfo>
 
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_K1620000 parameters</partinfo>
 
<partinfo>BBa_K1620000 parameters</partinfo>
 +
<!-- -->
 +
 +
__TOC__
 +
 +
==Usage and Biology==
 +
 +
<p align="justify">
 +
The universal stress protein A is a response of Escherichia coli cells to growth arrest, and its lacking generates cells with defective growth. For more information about this important protein, please feel free to visit the respective Wikigenes page (https://www.wikigenes.org/e/gene/e/948007.html).
 +
The universal stress protein A promoter (also as known as PuspA) is a well characterized promoter element, inducible under several stress conditions (Prytz et al. 2003; Dyk et al. 1995; Nyström and Neidhardt 1992; 1994). This genetic element is dependent to sigma-70 factor (Nyström and Neidhardt 1992; 1994). Its regulation is done through the concentration of a specific stationary phase allormone, guanosine-5'-diphosphate-3'-diphosphate (ppGp), as described elsewhere (Farewell et al. 1998b). The ppGp activate the transcription of downstream elements through a positive regulation of the β-subunit of RNA polymerase. In this sense, the PuspA element is considered a stationary phase promoter. However, in the work of Prytz et al. (2003) a constitutive transcription promotion was observed.
 +
</p>
 +
 +
<p align=”justify”>
 +
Diverse conditions make the Escherichia coli cell enter to stress state, like heat shocks, starvation, osmotic stress, ultraviolet light and other conditions. In these situations, the RNA polimerase sigma factors (ropS) trigger the expression of chaperones and other stress protector molecules, in order to help the cell survive. Previous works have showed the power of the element PuspA, like shown in the Table 1.
 +
</p>
 +
 +
[[Image:UFSCariGEM2006_Table1_UspAPromoter.jpg|450px|thumb|center|'''Table 1:''' Stress situations capable to induce the element PuspA. Response is given as a ratio of increase in signal of tested cells when compared with control cells.]]
 +
 +
==Promoter Design==
 +
 +
<p align="justify">
 +
The force of this genetic element is important for construction of several devices, since environmental monitoring of toxic compounds to devices of triggered expression like this specific situation. We have drawn the sequence for an improved PuspA promoter from an analysis of 400bp upstream the Universal Protein A (UspA) gene in E. coli K12. First we have used the Scope tool (http://genie.dartmouth.edu/scope/), and we found the domain WWRBAM:
 +
</p>
 +
 +
[[Image:UFSCariGEM2015_WWRBAM domain.jpg|450px|thumb|center|'''Figure 1:''' Domain WWRBAM obtained from analysis of 400pb upstream starting of UspA gene, using Scope.]]
 +
 +
<p align="justify">
 +
This analysis indicated to us the sequence 5'-AAGCAT-3' as vital and potential component of promoter region. Restarting the analysis with Neural Network Promoter Predictor (http://www.fruitfly.org/seq_tools/promoter.html), the following sequence was obtained:
 +
</p>
 +
 +
5' – TGAGTT''TTCAA''TCACCTTTCCATCCACC''TTATATTAA''GCA'''T'''GGAGG - 3'
 +
 +
<p align="justify">
 +
This sequence has a transcription starting at bolded T (-10) and italicized the sigma factor binding sites. The confidence of the promotion activity of this sequence was estimated as 100%. Using this part attached to the iGEM prefix and suffix through polymerase chain reaction (PCR), the construction of pSB1C3 derived vector was carried out with current assembly methods, as shown below (the orientation is 5' > 3'):
 +
</p>
 +
 +
[[Image:UFSCariGEM2015_pUSPA.jpg|450px|thumb|center|'''Figure 2:''' Promoter final construct.]]
 +
 +
<p align="justify">
 +
Interestingly, the lineages carrying these plasmids have a slow growth behavior, in comparison to cells carrying the pSB1C3 plasmid. In order to report its activity, we have fusioned the biobrick part BBa_E0840 (RBS/B0030+GFP/E0040+Terminator/B0015) downstream to our promoter making other new biobrick <partinfo>BBa_K1620005</partinfo>. This construct was used to evaluate the puspA element activity. Since the start, we observed a green color in colonies of E. coli DH5α after their growth at 37°C and posterior incubation for 16h at 4°C in lysogenic agar supplemented with chloramphenicol 10 μg/mL (LB agar plus Chloram.). These colonies were selected and passed through a confirmatory polymerase chain reaction. The best producing clone was selected and used for further experimentation and plasmid production.
 +
</p>
 +
 +
<br style="clear: both" />
 +
 +
==GFP expression tests==
 +
 +
===Test of cold shock===
 +
 +
<p align="justify">
 +
kkk
 +
</p>
 +
 +
<br style="clear: both" />
 +
 +
===Test of osmotic shock===
 +
 +
<p align="justify">
 +
kk
 +
</p>
 +
 +
<br style="clear: both" />
 +
 +
===Test of Starving===
 +
 +
<p align="justify">
 +
kkk
 +
</p>
 +
 +
<br style="clear: both" />
 +
 +
==Conclusions==
 +
 +
<p align="justify">
 +
KKK
 +
</p>
 +
 
<!-- -->
 
<!-- -->

Revision as of 17:36, 5 September 2015

Promoter element UspA

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage and Biology

The universal stress protein A is a response of Escherichia coli cells to growth arrest, and its lacking generates cells with defective growth. For more information about this important protein, please feel free to visit the respective Wikigenes page (https://www.wikigenes.org/e/gene/e/948007.html). The universal stress protein A promoter (also as known as PuspA) is a well characterized promoter element, inducible under several stress conditions (Prytz et al. 2003; Dyk et al. 1995; Nyström and Neidhardt 1992; 1994). This genetic element is dependent to sigma-70 factor (Nyström and Neidhardt 1992; 1994). Its regulation is done through the concentration of a specific stationary phase allormone, guanosine-5'-diphosphate-3'-diphosphate (ppGp), as described elsewhere (Farewell et al. 1998b). The ppGp activate the transcription of downstream elements through a positive regulation of the β-subunit of RNA polymerase. In this sense, the PuspA element is considered a stationary phase promoter. However, in the work of Prytz et al. (2003) a constitutive transcription promotion was observed.

Diverse conditions make the Escherichia coli cell enter to stress state, like heat shocks, starvation, osmotic stress, ultraviolet light and other conditions. In these situations, the RNA polimerase sigma factors (ropS) trigger the expression of chaperones and other stress protector molecules, in order to help the cell survive. Previous works have showed the power of the element PuspA, like shown in the Table 1.

Table 1: Stress situations capable to induce the element PuspA. Response is given as a ratio of increase in signal of tested cells when compared with control cells.

Promoter Design

The force of this genetic element is important for construction of several devices, since environmental monitoring of toxic compounds to devices of triggered expression like this specific situation. We have drawn the sequence for an improved PuspA promoter from an analysis of 400bp upstream the Universal Protein A (UspA) gene in E. coli K12. First we have used the Scope tool (http://genie.dartmouth.edu/scope/), and we found the domain WWRBAM:

Figure 1: Domain WWRBAM obtained from analysis of 400pb upstream starting of UspA gene, using Scope.

This analysis indicated to us the sequence 5'-AAGCAT-3' as vital and potential component of promoter region. Restarting the analysis with Neural Network Promoter Predictor (http://www.fruitfly.org/seq_tools/promoter.html), the following sequence was obtained:

5' – TGAGTTTTCAATCACCTTTCCATCCACCTTATATTAAGCATGGAGG - 3'

This sequence has a transcription starting at bolded T (-10) and italicized the sigma factor binding sites. The confidence of the promotion activity of this sequence was estimated as 100%. Using this part attached to the iGEM prefix and suffix through polymerase chain reaction (PCR), the construction of pSB1C3 derived vector was carried out with current assembly methods, as shown below (the orientation is 5' > 3'):

Figure 2: Promoter final construct.

Interestingly, the lineages carrying these plasmids have a slow growth behavior, in comparison to cells carrying the pSB1C3 plasmid. In order to report its activity, we have fusioned the biobrick part BBa_E0840 (RBS/B0030+GFP/E0040+Terminator/B0015) downstream to our promoter making other new biobrick BBa_K1620005. This construct was used to evaluate the puspA element activity. Since the start, we observed a green color in colonies of E. coli DH5α after their growth at 37°C and posterior incubation for 16h at 4°C in lysogenic agar supplemented with chloramphenicol 10 μg/mL (LB agar plus Chloram.). These colonies were selected and passed through a confirmatory polymerase chain reaction. The best producing clone was selected and used for further experimentation and plasmid production.


GFP expression tests

Test of cold shock

kkk


Test of osmotic shock

kk


Test of Starving

kkk


Conclusions

KKK