Difference between revisions of "Template:JCA Arkin RBSFamily"
Line 9: Line 9:
  
 
This feature in no way prevents the use of these parts in standard Biobrick assembly.  Normal prefix insertion into EcoRI/XbaI will delete this promoter element.  Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.
 
This feature in no way prevents the use of these parts in standard Biobrick assembly.  Normal prefix insertion into EcoRI/XbaI will delete this promoter element.  Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.
 +
 +
Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely
 +
"T".  The "G" downstream of the XbaI site obeys the standard.  Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.

Revision as of 22:16, 28 January 2007

Parts J61100-J61150 are a family of similar ribosome binding site basic parts identified from a saturation mutagenic library. 

 Library    TCTAGAGAAAGANNNGANNNACTAGT
 J61100     TCTAGAGAAAGAGGGGACAAACTAGT     clone D3
 J61101     TCTAGAGAAAGAGTGGAAAAACTAGT     clone D4

These parts are present in plasmid pSB1A2, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part J61100 reads: 

 Biobrick 5'    XbaI                    J23100              XbaI    RBS Part     Biobrick 3'
 gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctagaGAAAGAGGGGACAAactagtagcggccgctgcag

This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.

Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.