Difference between revisions of "Part:BBa K1722000"
Line 18: | Line 18: | ||
<html> | <html> | ||
− | <figure style="text-align: center"><img style="width:30%" src="https://static.igem.org/mediawiki/2015/2/26/HUPll_pcr2.png"/><figcaption style="text-align: | + | <figure style="text-align: center"><img style="width:30%" src="https://static.igem.org/mediawiki/2015/2/26/HUPll_pcr2.png"/><figcaption style="text-align:center"><b>Figure 1.</b> Electrophoretic analysis of PCR produution of hUPll promoter(1:PCR production 2:DL2000 DNA Marker)</figcaption></figure> |
</html> | </html> |
Revision as of 02:20, 4 September 2015
hUPll is a bladder tissue-specific promoter .
hUPll is a bladder tissue-specific promoter being found in human urothelium. Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein[1] and the expression of uroplakin II was found to be limited to bladder-derived cells.[2,3] Other members of uroplakins, including uroplakinla(UPla), uroplakinlb(UPlb), and uroplakinlll(UPlll), have also been characterized. Therefore, the promoters that direct the expression of the uroplakins may be useful in constructing tissue-specific vectors for bladder cancer gene therapy. Research shows that most of thecis elements that confer the bladder-specificity and differentiation-dependent expression of the human UPll gene reside in the 2542-bp sequence, and TNF driven by the human UPll(hUPll) promoter is effective in the specific inhibition of bladder cancer growth both in vivo and in vitro. Zhu et al transtected the plasmid phUPll-EGFP containing DNA fragment(hUPll) into bladder cancer(BIU-87), renal carcinoma(GRC-1) and endothelial(EC) cell lines.[4](Fig. 1)
2015 SZU-iGEM use hUPII to drive the expression of the therapeutic genes(such as p21 and Bax) so that the gene is expressed only in bladder cells and systematic toxicity is minimized. We tested hUPII promoter in HFC(Human Fiber Epithelial Cells),5637,T24 and Hela cell lines. HFC are normal bladder cells, 5637 and T24 are bladder cancer cells while Hela are cervical cancer cells. Result shows it can confer preferential expression of genes in the bladder urothelium like HFC, 5637 and T24, which indicates hUPll has high efficiency in specifically recognizing bladder cells.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
We designed the following primers and amplified hUPII promoter from the vector psi-Check2:
CCGGAATTCATCGGGTGATCAGTACTCC(up) TGCACTGCAGACTAGTACTGAGCTGTGAGGT(down)
By incorporating these primers into hUPII promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.
Source
hUPII gene was achieved from Shenzhen Second People's Hospital. We read a scientific treatise talking about targeted therapy of bladder cancer written by a doctor in Shenzhen Second People's Hospital and tried to seek cooperation with them. Fortunately, they agree to provide us hUPII with psi-Check2 as its vector.
References
[1]Wu XR, Lin JH, Walz T, et al. Mammalian uroplakins, a group of highly conserved urothelial differentiation related membrane proteins. J Biol Chem. 1994;269:13716–13724.
[2]Yuasa T, Yoshiki T, Isono T, et al. Expression of transitional cell specific genes uroplakin Ia and II in bladder cancer detection of circulating cancer cells in the peripheral blood of metastatic patients. Int J Urol. 1999;6:286–292.
[3]Moll R, Wu XR, Lin JH, Sun TT. Uroplakins specific membrane proteins of urothelial umbrella cells as histological markers of metastatic transitional cell carcinomas. Am J Pathol. 1995;147:1383–1397.
[4]Zhu H J, Zhang ZQ, Zeng XF, et al. Cloning and analysis of human uroplakin II promoter and its ap plication for gene therapy in bladder cancer[J] Cancer Gene Ther, 2004, 11: 263-272