Difference between revisions of "Part:BBa K310004:Experience"
Sarahwideman (Talk | contribs) (→Stockholm 2015 iGEM Team) |
Sarahwideman (Talk | contribs) (→User Reviews) |
||
Line 53: | Line 53: | ||
<I>Stockholm 2015</I> | <I>Stockholm 2015</I> | ||
|width='60%' valign='top'| | |width='60%' valign='top'| | ||
− | This part | + | This part is not the MicF target. |
|}; | |}; |
Revision as of 20:40, 19 August 2015
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K310004
Stockholm 2015 iGEM Team
This part doesn’t work. The part is not the described MicF target, rather it appears to be a Cu-responsive transcriptional regulator from Salmonella enterica.
Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.
We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.
Left: restriction analysis gel of K310004 in pSB1C3, digested with EcoRI and PstI.
Middle: Simulated gel (SnapGene) with K310004 sequence provided by iGEM Team UIUC Illinois 2010.
Right: Simulated gel (SnapGene) with K310004 sequence provided by iGEM Team Stockholm 2015
>BBa_K310004 Part-only sequence (684 bp)
AAAGAGGAGAAATACTAGATGCAGTTCCATATTGATGACATGACCTGCGGCGGCTGCGCCAGTACGGTAAAAAAGACGATTCTGACTCTCGA
TGCTAATGCGACGGTGAGAACTGACCCGGCGACGCGTCTGGTTGACGTTGAAACGTCGCTATCCGCGGAGCAGATTGCCGCCGCCCTGCAA
AAGGCCGGTTTCCCGCCGCGCGAGACCTAATACTAGATGAACATCGGTAAAGCAGCTAAAGCATCGAAAGTCTCGGCCAAAATGATTCGCTA
CTATGAACAGATTGGTCTGATTCCCGCGGCAAGTCGGACGGATTCCGGCTATCGGGCCTATACCCAGGCTGATGTTAATCAATTGCATTTTAT
ACGCCGCGCGCGCGACCTCGGTTTTTCAGTTGCTGAAATCAGCGACTTACTGAATCTTTGGAATAACCAGTCGCGGCAAAGCGCTGACGTCA
AACGCCTGGCGCAGACGCACATTGATGAACTGGACAGACGTATCCAGAACATGCAGCACATGGCGCAAACCCTCAAAGCGCTGATTCACTG
CTGCGCCGGCGACGCGCTGCCAGATTGCCCCATTCTGCATACGCTTGGA
User Reviews
UNIQ972ef98b11eb6c3c-partinfo-00000000-QINU
Stockholm 2015 |
This part is not the MicF target. |