Difference between revisions of "Part:BBa K310004:Experience"

(→‎Applications of BBa_K310004)
(→‎Stockholm 2015 iGEM Team)
Line 4: Line 4:
  
 
===Applications of BBa_K310004===
 
===Applications of BBa_K310004===
 +
  
  
Line 12: Line 13:
  
 
Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.  
 
Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.  
 +
 +
We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.
 +
  
 
[[File:K310004 restriction analysis Stockholm 2015.png|border|Restriction Analysis]]  
 
[[File:K310004 restriction analysis Stockholm 2015.png|border|Restriction Analysis]]  
Line 20: Line 24:
  
 
'''Right''': Simulated gel (SnapGene) with K310004 sequence provided by iGEM Team Stockholm 2015
 
'''Right''': Simulated gel (SnapGene) with K310004 sequence provided by iGEM Team Stockholm 2015
−
 
−
 
−
We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.
 
  
  
Line 40: Line 41:
 
|-
 
|-
 
|width='10%'|
 
|width='10%'|
−
<partinfo>BBa_K310004 AddReview 0 </partinfo>
+
<partinfo>BBa_J04450 AddReview number</partinfo>
−
<I>Stockholm 2015</I>
+
<I>Username</I>
 
|width='60%' valign='top'|
 
|width='60%' valign='top'|
−
This part doesn’t work. The part is not the described MicF target, rather it appears to be a Cu-responsive transcriptional regulator from Salmonella enterica.
+
Enter the review inofrmation here.
−
Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.  We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.
+
|};
−
|}
+
 
<!-- End of the user review template -->
 
<!-- End of the user review template -->
−
<!-- DON'T DELETE --><partinfo>BBa_K310004 EndReviews</partinfo>
+
{|width='80%' style='border:1px solid gray'
 +
|-
 +
|width='10%'|
 +
<partinfo>BBa_K310004 AddReview 0</partinfo>
 +
<I>Stockholm 2015</I>
 +
|width='60%' valign='top'|
 +
This part doesn't work.
 +
|};

Revision as of 20:38, 19 August 2015

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K310004

Stockholm 2015 iGEM Team

This part doesn’t work. The part is not the described MicF target, rather it appears to be a Cu-responsive transcriptional regulator from Salmonella enterica.

Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.

We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.


Restriction Analysis

Left: restriction analysis gel of K310004 in pSB1C3, digested with EcoRI and PstI.

Middle: Simulated gel (SnapGene) with K310004 sequence provided by iGEM Team UIUC Illinois 2010.

Right: Simulated gel (SnapGene) with K310004 sequence provided by iGEM Team Stockholm 2015


>BBa_K310004 Part-only sequence (684 bp) AAAGAGGAGAAATACTAGATGCAGTTCCATATTGATGACATGACCTGCGGCGGCTGCGCCAGTACGGTAAAAAAGACGATTCTGACTCTCGA TGCTAATGCGACGGTGAGAACTGACCCGGCGACGCGTCTGGTTGACGTTGAAACGTCGCTATCCGCGGAGCAGATTGCCGCCGCCCTGCAA AAGGCCGGTTTCCCGCCGCGCGAGACCTAATACTAGATGAACATCGGTAAAGCAGCTAAAGCATCGAAAGTCTCGGCCAAAATGATTCGCTA CTATGAACAGATTGGTCTGATTCCCGCGGCAAGTCGGACGGATTCCGGCTATCGGGCCTATACCCAGGCTGATGTTAATCAATTGCATTTTAT ACGCCGCGCGCGCGACCTCGGTTTTTCAGTTGCTGAAATCAGCGACTTACTGAATCTTTGGAATAACCAGTCGCGGCAAAGCGCTGACGTCA AACGCCTGGCGCAGACGCACATTGATGAACTGGACAGACGTATCCAGAACATGCAGCACATGGCGCAAACCCTCAAAGCGCTGATTCACTG CTGCGCCGGCGACGCGCTGCCAGATTGCCCCATTCTGCATACGCTTGGA

User Reviews

UNIQ0fda599961bb3a11-partinfo-00000000-QINU

Stockholm 2015

This part doesn't work.

;