Difference between revisions of "Part:BBa K1351019"
| Line 25: | Line 25: | ||
[[File:Sdpianti.JPG|600px]] | [[File:Sdpianti.JPG|600px]] | ||
| − | The graph shows growth curves of ''Bacillus subtilis'' wildtype, a ''SdpI'' deletion strain, a strain with our BioBrick [https://parts.igem.org/wiki/index.php?title=Part: | + | The graph shows growth curves of ''Bacillus subtilis'' wildtype, a ''SdpI'' deletion strain, a strain with our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351019 BBa_K1351019] as well as a strain carrying our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351017 BBa_K1351017]. |
The results were performed with our protocoll: [https://static.igem.org/mediawiki/2014/c/c7/LMU-Munich14_Luminescence_Assay.pdf Lumi Assay] in MCSE and consist of three replicas of three measurements. The induction of was performed with 0.2% xylose. | The results were performed with our protocoll: [https://static.igem.org/mediawiki/2014/c/c7/LMU-Munich14_Luminescence_Assay.pdf Lumi Assay] in MCSE and consist of three replicas of three measurements. The induction of was performed with 0.2% xylose. | ||
| − | These results show that our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351019 BBa_K1351019] has no impact on the ''SdpI'' immunity. Expected was a decrease of immunity in late stationary phase | + | These results show that our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351019 BBa_K1351019] has no impact on the ''SdpI'' immunity. Expected was a decrease of immunity in late stationary phase comparible with the deletion of ''SdpI''. |
<br><br> | <br><br> | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
Latest revision as of 17:56, 30 October 2014
Reverse complementary RNA sequence which binds the mRNA of the SdpI immunity
Artificial constructed complementary RNA which should bind the mRNA of the SdpI immunity protein (BBa_K1351017) in Bacillus subtilis in order to disturb the translation of immunity. Expected was a loss of immunity in B. subtilis against its own cannibalism toxin SDP (BBa_K1351043) over time.
This part was generated with the RFC10 standard and has the following prefix and suffix:
| prefix with EcoRI, NotI and XbaI: | GAATTCGCGGCCGCTTCTAGAG |
| suffix with SpeI, NotI and PstI: | TACTAGTAGCGGCCGCTGCAG |
Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]
First results of this BioBrick are depicted in the following graph:
The graph shows growth curves of Bacillus subtilis wildtype, a SdpI deletion strain, a strain with our BioBrick BBa_K1351019 as well as a strain carrying our BioBrick BBa_K1351017.
The results were performed with our protocoll: Lumi Assay in MCSE and consist of three replicas of three measurements. The induction of was performed with 0.2% xylose.
These results show that our BioBrick BBa_K1351019 has no impact on the SdpI immunity. Expected was a decrease of immunity in late stationary phase comparible with the deletion of SdpI.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]