Difference between revisions of "Part:BBa K1351014"
Line 7: | Line 7: | ||
<b>Immunity</b> | <b>Immunity</b> | ||
− | [[File:LMU14 killing subtilin Immunity assay.png | + | [[File:LMU14 killing subtilin Immunity assay.png|600px|center|Fig. 1. Supernatant-in-lawn assay shows smaller halo diameters for ''B. subtilis'' with BioBRick-acquired immunity. ]] |
The part was evaluated with a variation of an spot-on-lawn assay. In this case, holes were cut out of agar plates on which either ''B. subtilis'' W168 wild type or ''B. subtilis'' W168 ''amyE''::P<sub>''xyl''</sub>_''spaIFEG'' were plated. The holes were then filled with different amounts of sterile supernatant from overnight cultures of W168 or ATCC6633, respectively. The xylose-containing plates were incubated at 37 °C for 24 h and resulting halo diameters were measured. The supernatant derived from the negative control (W168) did not cause any growth inhibition to neither the wild type, nor to the strain who carries the immunity BioBrick (Figure XY). The subtilin-containing supernatant from ''B. subtilis'' ATCC6633 however, was able to inhibit the growth of both bacterial lawns. For the lowest amounts (32 µl), no significant difference between the halo diameters could be determined. The larger the amount of supernatant, and presumably, the higher the amount of subtilin in there, the bigger the zones of inhibition. For the largest volume (128 µl), a two-sided T-test could determine the p-value below 0.1 (p=0,007762603) and by this prove the functionality of this BioBrick. This is a major step for this project, as the immunity is the base for any strain which produces antimicrobial peptides. Now further steps can be taken and the remaining BioBricks can be evaluated. | The part was evaluated with a variation of an spot-on-lawn assay. In this case, holes were cut out of agar plates on which either ''B. subtilis'' W168 wild type or ''B. subtilis'' W168 ''amyE''::P<sub>''xyl''</sub>_''spaIFEG'' were plated. The holes were then filled with different amounts of sterile supernatant from overnight cultures of W168 or ATCC6633, respectively. The xylose-containing plates were incubated at 37 °C for 24 h and resulting halo diameters were measured. The supernatant derived from the negative control (W168) did not cause any growth inhibition to neither the wild type, nor to the strain who carries the immunity BioBrick (Figure XY). The subtilin-containing supernatant from ''B. subtilis'' ATCC6633 however, was able to inhibit the growth of both bacterial lawns. For the lowest amounts (32 µl), no significant difference between the halo diameters could be determined. The larger the amount of supernatant, and presumably, the higher the amount of subtilin in there, the bigger the zones of inhibition. For the largest volume (128 µl), a two-sided T-test could determine the p-value below 0.1 (p=0,007762603) and by this prove the functionality of this BioBrick. This is a major step for this project, as the immunity is the base for any strain which produces antimicrobial peptides. Now further steps can be taken and the remaining BioBricks can be evaluated. | ||
Revision as of 14:38, 29 October 2014
spaIFEG Subtilin (Immunity)
spaIFEG are coding for immunity to the antibiotic subtilin in Bacillus subtilis ATCC6633. spaI: Lipoprotein, spaFEG: ABC-Transporter
Immunity
The part was evaluated with a variation of an spot-on-lawn assay. In this case, holes were cut out of agar plates on which either B. subtilis W168 wild type or B. subtilis W168 amyE::Pxyl_spaIFEG were plated. The holes were then filled with different amounts of sterile supernatant from overnight cultures of W168 or ATCC6633, respectively. The xylose-containing plates were incubated at 37 °C for 24 h and resulting halo diameters were measured. The supernatant derived from the negative control (W168) did not cause any growth inhibition to neither the wild type, nor to the strain who carries the immunity BioBrick (Figure XY). The subtilin-containing supernatant from B. subtilis ATCC6633 however, was able to inhibit the growth of both bacterial lawns. For the lowest amounts (32 µl), no significant difference between the halo diameters could be determined. The larger the amount of supernatant, and presumably, the higher the amount of subtilin in there, the bigger the zones of inhibition. For the largest volume (128 µl), a two-sided T-test could determine the p-value below 0.1 (p=0,007762603) and by this prove the functionality of this BioBrick. This is a major step for this project, as the immunity is the base for any strain which produces antimicrobial peptides. Now further steps can be taken and the remaining BioBricks can be evaluated.
This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
prefix with EcoRI, NotI, XbaI, SD and NgoMIV: | GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC |
suffix with AgeI, SpeI, NotI and PstI: | ACCGGTTAATACTAGTAGCGGCCGCTGCAG |
Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 722
Illegal BglII site found at 1470 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 1737
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1017
Illegal SapI site found at 1297
Illegal SapI.rc site found at 2020