Difference between revisions of "Part:BBa K1351019"

Revision as of 10:07, 27 October 2014

Reverse complementary RNA sequence which binds the mRNA of the SdpI immunity

Artificial constructed complementary RNA which should bind the mRNA of the SdpI immunity protein (BBa_K1351017) in Bacillus subtilis in order to disturb the translation of immunity. Expected was a loss of immunity in B. subtilis against its own cannibalism toxin SdpC SdpC (BBa_K1351043) over time.

Prefix: TGCAGAATTCGCGGCCGCTTCTAGAG
Suffix: TACTAGTAGCGGCCGCTGCAGGCT
Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

First results of this BioBrick are depicted in the following graph:

The graph shows grwoth curves of Bacillus subtilis wildtype, a SdpI deletion strain, a strain with our BioBrick BBa_K1351017 as well as a strain carrying our BioBrick BBa_K1351019 in trans. The results were performed with our protocoll: Lumi Assay in MCSE and consist of three replicas of three measurements. The induction of was performed with 0.2% xylose. These results show that our BioBrick BBa_K1351019 has no impact on the SdpI immunity. Expected was a decrease of immunity in late stationary phase somehow comparible with the deletion of SdpI.

Sequence and Features