Difference between revisions of "Part:BBa K1351017"

Revision as of 10:06, 27 October 2014

SdpI with RBS: Immunity against the cannibalsim toxin sdpC of B. subtilis

This gene codes for the immunity against a cannibalism toxin SdpC of Bacillus subtilis. The sdpI gene is regulated by a separate promoter (PsdpIR) which is responsible for the operon sdpIR. Cannibalsim toxins are produced by B. subtilis mainly in mid to late stationary phase when nutrients are limited. We wanted to evaluate the immunity in order to later on interferre with it for our module: [http://2014.igem.org/Team:LMU-Munich/Project/Bakillus suicide]. For more details on our interference strategies please check our antisense mRNA BBa_K1351019.

Prefix: TGCAGAATTCGCGGCCGCTTCTAGAGTAAGGAGGAACTACT
Suffix: TACTAGTAGCGGCCGCTGCAGGCT
Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

First results of this BioBrick are depicted in the following graph:

The graph shows grwoth curves of Bacillus subtilis wildtype, a SdpI deletion strain as well as a strain carrying our BioBrick BBa_K1351017 in trans. The results were performed with our protocoll: Lumi Assay in MCSE and consist of three replicas of three measurements. The induction of was performed with 0.2% xylose. These results clearly show that our BioBrick BBa_K1351017 is functional and recovers wild type grwoth behavior.

Sequence and Features