Difference between revisions of "Part:BBa K1351025"
Line 30: | Line 30: | ||
[[File:LMU14_doseresponse.png|500px]] | [[File:LMU14_doseresponse.png|500px]] | ||
− | + | Luminescence of ''B. subtilis'' P<sub>''xyl''</sub> - ''comDE'' / P<sub>''comC''</sub> and P<sub>''xyl''</sub> - ''comDE'' / P<sub>''comAB''</sub> was measured growing the cultures in MCSE and inducing with 0.02 % xylose and different CSP concentrations (100 ng/ml, 300ng/ml, 500 ng/ml, 1000 ng/ml, 3000 ng/ml, 5000 ng/ml, 8000 ng/ml and 10000 ng/ml). The activation of P<sub>''comC''</sub> and P<sub>''comAB''</sub> responds directly on the CSP concentration. | |
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Latest revision as of 11:59, 26 October 2014
PcomAB, a CSP inducible promoter derived from Streptococcus pneumoniae
CSP-depending promoter PcomAB of the two component system ComDE (BBa_K1351015, BBa_K1351016) in Streptococcus pneumoniae (R6). This regulatory site has been shown to be sufficient to drive ComE regulated transcription within S. pneumoniae [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay].
CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. BBa_K1351024 is another BioBrick containing comC promoter of S. pneumoniae with an other CEbs.
ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)]
This part was generated with the RFC10 standard and has the following prefix and suffix:
prefix with EcoRI, NotI and XbaI: | GAATTCGCGGCCGCTTCTAGAG |
suffix with SpeI, NotI and PstI: | TACTAGTAGCGGCCGCTGCAG |
Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
In the following graph, a dose response curve of the two CSP inducible promoters PcomC and PcomAB is depicted. The dose response curve was generating using luminescence values two hours after inducing with CSP.
Luminescence of B. subtilis Pxyl - comDE / PcomC and Pxyl - comDE / PcomAB was measured growing the cultures in MCSE and inducing with 0.02 % xylose and different CSP concentrations (100 ng/ml, 300ng/ml, 500 ng/ml, 1000 ng/ml, 3000 ng/ml, 5000 ng/ml, 8000 ng/ml and 10000 ng/ml). The activation of PcomC and PcomAB responds directly on the CSP concentration.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
References
<biblio>
- 1 ComE/ComE~P interplay dictates activation or extinction status of pneumococcal X-state (competence). Martin et al (2012) [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay]
</biblio>