Difference between revisions of "Part:BBa K1366102"

Latest revision as of 03:24, 18 October 2014

Genetic construct for msbB gene deletion (C2)

This construct contains the sequence homologies to delete the msbB gene (Braun’s lipoprotein) with a kanamycin resistance and the sequences for the Lux I production (AHL synthase). The deletion of msbB gene and the replacement of that sequence with the Kan resistance and LuxI will be performed with the red-lambda system. The FTR sequences included are used to remove the antibiotic resistance with a specific recombinase.

After the lambda-red protocol was performed and the cells underwent an electroporation with the digestions carrying BBa_K1366101 and BBa_K1366102 (See protocol 9); the cells were submitted to antibiotic selection and only four plates presented E. coli colonies. Those were BBa_K1366101 + BBa_K1366102 with the LuxR and LuxI parts of the Quorum sensing of Vibrio fischeri respectively (Fig. 1), BBa_K1366101 with the LuxR (Fig. 2), BBa_K1366102 with the LuxI (Fig. 3), and BBa_K1366102 without any additional part inserted (Fig. 4).

Fig. 1

Fig. 2

Fig. 3

Fig. 4

In order to corroborate these results, the circled colonies in the images were submitted to a PCR analysis. For BBa_K1366101 recombination, the pair of primers used were:

Forward: ACTCAGGGCGGTAAATCTGC

Reverse: ATGGTGAACCAGAGCAAGGG

For this reaction the expected amplicons were 936 bp for the wild type, 1875 bp for the inserted biobrick in the genome without any additional part, and 2765 bp for the inserted biobrick with the LuxR part of the Quorum Sensing. For BBa_K1366101 recombination, the pair of primers used were:

Forward: GGGTAAAGGTGAAGGCGACA

Reverse: TTGCACCACACAGAGGTGTT

And the expected amplicons were, for the wild type E. coli 2757 pb, 2881 bp for the inserted biobrick in the genome without any additional part and 3569 bp for the inserted biobrick with the LuxI part of the Quorum Sensing. All PCR parameters used are based in the protocol for Q5 High-Fidelity 2X Master Mix by New England BioLabs. The results of the first round of PCR are presented in the next image:

According to this electrophoresis gel, BBa_K1366101 was not inserted in E. coli genome. However it can be seen that BBa_K1366102 with the LuxI sequence from Quorum sensing was incorporated to the bacteria’s genome. For this reason we conclude that BBa_K1366102 combined with the lambda-red system is functional and can be used to delete msbB gen and incorporate any other sequence in E. coli’s DNA. During the following weeks, prior Giant Jamboree, we will be trying to delete lpp gen with BBa_K1366101, and implement the inflammation test, to prove that both deletions minimize the immune system response, thus demonstrating that an attenuated E. coli can be a useful vector for localized and specific cancer therapies, making it safer to use bacteria as a delivery system.

Finally the gel restriction analysis with the proof of the transformation of both C1 and C2:

Sequence and Features