Difference between revisions of "Part:BBa K1431302:Design"

Revision as of 03:24, 18 October 2014

SV40 promoter+SV40 PolyA

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

Design Notes

For BbsI site, we have a series same design sequence. See the mechanism of BbsI site work below.

Fig.1 The Machanism of Our Standard

If you want to insert a coding sequence between promoter and polyA, the prefix of forward primer you design must contain GAAGACNNtaaaNNNN and reverse must contain GAAGACNNagttNNNN. The middle two Ns would be any bases for them will be cut off and the four Ns should be begins or ends of the coding sequence. You can get parts by above primers and digest by BbsI restriction enzyme. Then you can insert the parts into promoter and polyA seamless. The PCR product must be such sequence, including the protect bases, shows below.

Fig.2 PCR Product Sequence

And the reason why we designed that because we want to make a seamless gather between NLS and protein or any triple nucleotides. That depend on which will make the highest efficiency.

Sequencing Results

We sent fresh bacteria broth for sequencing using standard Biobricks sequencing primer VF2/VR. The sequencing cooperation we used is Invitrogen Guangzhou filiale.

Sequence of sequencing primer we used:
VF2: tgccacctgacgtctaagaa
VR: attaccgcctttgagtgagc

The result shows the same sequence with our ideal design.

Source

The plasmid was from our instructor, Huangwei's lab. And we design primers to copy down by PCR.

===References===

@@ Line 1: / Line 1: @@
 __NOTOC__
 <partinfo>BBa_K1431302 short</partinfo>
@@ Line 7: / Line 6: @@
 ===Design Notes===
-For BbsI site, we have a series same design sequence. You can get how BbsI site work by google. And the reason why we designed that because we want  to make coding sequence seamless gather with promoter and PolyA or any amount nucleotides. That depend on which will make the highest efficiency. Sorry for the limited time, we only test GFP seamless gather with promoter and PolyA but did not get the data which will make the highest efficiency.
+For BbsI site, we have a series same design sequence.  See the mechanism of BbsI site work below.
+<center>https://static.igem.org/mediawiki/parts/archive/a/ab/20141018014544%21Our_RFC.png</center>
+<center>'''Fig.1  The Machanism of Our Standard'''</center>
+If you want to insert a coding sequence between promoter and polyA, the prefix of forward primer you design must contain '''GAAGACNN<span style="color: red">taaa<span style="color: black">NNNN''' and reverse must contain '''GAAGACNN<span style="color: red">agtt<span style="color: black">NNNN'''. The middle two Ns would be any bases for them will be cut off and the four Ns should be begins or ends of the coding sequence. You can get parts by above primers and digest by BbsI restriction enzyme. Then you can insert the parts into promoter and polyA seamless. The PCR product must be such sequence, including the protect bases, shows below.
+<center>https://static.igem.org/mediawiki/parts/1/1b/PCR_product_by_new_RFC.png</center>
+<center>'''Fig.2   PCR Product Sequence'''</center>
+And the reason why we designed that because we want to make a seamless gather between NLS and protein or any triple nucleotides. That depend on which will make the highest efficiency.
+===Sequencing Results===
+We sent fresh bacteria broth for sequencing using standard Biobricks sequencing primer VF2/VR. The sequencing cooperation we used is Invitrogen Guangzhou filiale.
+Sequence of sequencing primer we used:<br>
+VF2: tgccacctgacgtctaagaa<br>
+VR: attaccgcctttgagtgagc
+The result shows the same sequence with our ideal design.
 ===Source===
-It is from our instructor's lab.
+The plasmid was from our instructor, Huangwei's lab. And we design primers to copy down by PCR.
 ===References===