Difference between revisions of "Part:BBa K1431201:Design"
(→References) |
|||
Line 18: | Line 18: | ||
And the reason why we designed that because we want to make a seamless gather between NLS and protein or any triple nucleotides. That depend on which will make the highest efficiency. | And the reason why we designed that because we want to make a seamless gather between NLS and protein or any triple nucleotides. That depend on which will make the highest efficiency. | ||
+ | ===Sequencing Results=== | ||
+ | |||
+ | We sent fresh bacteria broth for sequencing using standard Biobricks sequencing primer VF2/VR. The sequencing cooperation we used is Invitrogen Guangzhou filiale. | ||
+ | |||
+ | Sequence of sequencing primer we used:<br> | ||
+ | VF2: tgccacctgacgtctaagaa<br> | ||
+ | VR: attaccgcctttgagtgagc | ||
+ | |||
+ | The result shows the same sequence with our ideal design. | ||
==='''Source'''=== | ==='''Source'''=== |
Latest revision as of 03:17, 18 October 2014
NLS, lead protein into the nucleus
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 66
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 88
Illegal NgoMIV site found at 107 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
We have anther kind of NLS but only with one side. We chose two NLS for it may increase the probability of protein import into the cell nucleus. As for BbsI site, we have a series same design sequence. See the mechanism of BbsI site work below.
![Our_RFC.png](https://static.igem.org/mediawiki/parts/a/ab/Our_RFC.png)
If you want to insert a coding sequence between NLS, the prefix of forward primer you design must contain GAAGACNNtaaaNNNN and reverse must contain GAAGACNNagttNNNN. The middle two Ns would be any bases for them will be cut off and the four Ns should be begins or ends of the coding sequence. You can get parts by above primers and digest by BbsI restriction enzyme. Then you can insert the parts into two NLS seamless. The PCR product must be such sequence, including the protect bases, shows below.
![PCR_product_by_new_RFC.png](https://static.igem.org/mediawiki/parts/1/1b/PCR_product_by_new_RFC.png)
And the reason why we designed that because we want to make a seamless gather between NLS and protein or any triple nucleotides. That depend on which will make the highest efficiency.
Sequencing Results
We sent fresh bacteria broth for sequencing using standard Biobricks sequencing primer VF2/VR. The sequencing cooperation we used is Invitrogen Guangzhou filiale.
Sequence of sequencing primer we used:
VF2: tgccacctgacgtctaagaa
VR: attaccgcctttgagtgagc
The result shows the same sequence with our ideal design.
Source
These two NLS sequence was from two sides in Cas9 sequence, plasmid px330, zhangfeng lab. For the too length and repeat A&G bases, we completely synthesis the sequence and add two BbsI site specially.
References
[http://zlab.mit.edu zhangfeng lab]
http://en.wikipedia.org/wiki/Nuclear_localization_sequence