Difference between revisions of "Part:BBa K1351024"
Line 2: | Line 2: | ||
<partinfo>BBa_K1351024 short</partinfo> | <partinfo>BBa_K1351024 short</partinfo> | ||
− | CSP-depending promoter of the two component system ComDE in ''Streptococcus pneumoniae'' (R6). This regulatory site has been shown to be sufficient to drive ComE regulated transcription within ''S. pneumoniae'' [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay]. | + | CSP-depending promoter of the two component system ComDE ([https://parts.igem.org/Part:BBa_K1351015 BBa_K1351015]) in ''Streptococcus pneumoniae'' (R6). This regulatory site has been shown to be sufficient to drive ComE regulated transcription within ''S. pneumoniae'' [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay]. |
CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. [https://parts.igem.org/Part:BBa_K1351025 BBa_K1351025] is another BioBrick containing ''comAB'' promoter of ''S. pneumoniae'' with an other CEbs. | CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. [https://parts.igem.org/Part:BBa_K1351025 BBa_K1351025] is another BioBrick containing ''comAB'' promoter of ''S. pneumoniae'' with an other CEbs. |
Revision as of 19:21, 17 October 2014
PcomC, a CSP inducible promoter derived from Streptococcus pneumoniae
CSP-depending promoter of the two component system ComDE (BBa_K1351015) in Streptococcus pneumoniae (R6). This regulatory site has been shown to be sufficient to drive ComE regulated transcription within S. pneumoniae [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay].
CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. BBa_K1351025 is another BioBrick containing comAB promoter of S. pneumoniae with an other CEbs.
ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)]
This part was generated with the RFC10 standard and has the following prefix and suffix:
prefix with EcoRI, NotI and XbaI: | GAATTCGCGGCCGCTTCTAGAG |
suffix with SpeI, NotI and PstI: | TACTAGTAGCGGCCGCTGCAG |
Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
References
<biblio>
- 1 ComE/ComE~P interplay dictates activation or extinction status of pneumococcal X-state (competence). Martin et al (2012) [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay]
</biblio>