Difference between revisions of "Part:BBa K1497026:Design"
(→Design Notes) |
|||
| Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
The follow DNA sequence is the right DNA sequence of this part. After the giant jamborre we are able to replace the wrong sequence against this sequence. | The follow DNA sequence is the right DNA sequence of this part. After the giant jamborre we are able to replace the wrong sequence against this sequence. | ||
| − | <pre> | + | <pre> |
| − | + | ||
| − | + | ||
AGATCTCTGCAACGTCGTCGTGTTACCGTTCGTAAAGCAGATGCCGGTGGTCTGGGTATTAGCATTAAAGGTGGTCGTGA | AGATCTCTGCAACGTCGTCGTGTTACCGTTCGTAAAGCAGATGCCGGTGGTCTGGGTATTAGCATTAAAGGTGGTCGTGA | ||
AAACAAAATGCCGATCCTGATTAGCAAAATCTTTAAAGGTCTGGCAGCAGATCAGACCGAAGCCCTGTTTGTTGGTGATG | AAACAAAATGCCGATCCTGATTAGCAAAATCTTTAAAGGTCTGGCAGCAGATCAGACCGAAGCCCTGTTTGTTGGTGATG | ||
| Line 39: | Line 37: | ||
</div> | </div> | ||
</html> | </html> | ||
| − | |||
| − | |||
===Source=== | ===Source=== | ||
Latest revision as of 19:18, 17 October 2014
PDZ-Domain
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1
Illegal BamHI site found at 226 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
The follow DNA sequence is the right DNA sequence of this part. After the giant jamborre we are able to replace the wrong sequence against this sequence.
AGATCTCTGCAACGTCGTCGTGTTACCGTTCGTAAAGCAGATGCCGGTGGTCTGGGTATTAGCATTAAAGGTGGTCGTGA AAACAAAATGCCGATCCTGATTAGCAAAATCTTTAAAGGTCTGGCAGCAGATCAGACCGAAGCCCTGTTTGTTGGTGATG CAATTCTGAGCGTTAATGGTGAGGACCTGAGCAGCGCAACCCATGATGAAGCAGTTCAGGCACTGAAAAAAACAGGTAAA GAAGTTGTGCTGGAAGTCAAATACATGAAAGAAGTTAGCCCGTATTTCAAAGGTTCAGGCTCAGGCTCTGGAAGCGGAAG CGGTAGTGGGAGCGGCAGCGGATCC
As usual, a backbone is ligated with an insert to create the desired sequence. For example a new scaffold protein consisting of two domains can be constructed by ligating a backbone vector including the desired N-terminal scaffold domain with an insert containing the desired C-terminal domain. For this, the backbone has to be digested with the restriction enzymes BamHI and PstI cleaving the plasmid downstream of the first domain. In contrast, the insert has to be extracted from its vector by digestion with BglII and PstI. The overlap sequcences of the BglII and BamHI restriction sites are complementary. Thus, the insert can be ligated behind the first domain into the backbone. The scar sequence resulting from a combination of a BglII with BamHI restriction site cannot be recognized by nether of the enzymes. Therefore, a single ligation creates a new scaffold BioBrick immediately, which is again flanked by a BglII and BamHI sequence. Of course, more sophisticated scaffold BioBricks can therefore be constructed from composite BioBricks containing more than one domain or again by iterative cloning of single domains behind an initial domain.
Figure 2:
Cloning scheme for the construction of scaffold proteins. To assemble domains for the construction of a new scaffold protein, the backbone containing the N-terminal domain(s) can be digested with BamHI and PstI and the C-terminal domain(s) can be cut from the plasmid with BglII and PstI. The ligation of the two DNA fragments creates a new BioBrick, which can also be used for the construction of new scaffold proteins. Further scaffold proteins can be elongated by adding domains through the C-terminal BamHI site. The variability of the scaffold proteins can be increased by assembly of different domains. |
Source
Rattus rattus.
References
|
Dueber, John E.; Wu, Gabriel C.; Malmirchegini, G. Reza; Moon, Tae Seok; Petzold, Christopher J.; Ullal, Adeeti V. et al. (2009): Synthetic protein scaffolds provide modular control over metabolic flux. In Nat. Biotechnol. 27 (8), pp. 753–759. DOI: 10.1038/nbt.1557. Schultz, J.; Hoffmüller, U.; Krause, G.; Ashurst, J.; Macias, M. J.; Schmieder, P. et al. (1998): Specific interactions between the syntrophin PDZ domain and voltage-gated sodium channels. In Nat. Struct. Biol. 5 (1), pp. 19–24. |