Difference between revisions of "Part:BBa K1351040"

Revision as of 19:02, 17 October 2014

pBS0KPspac, an IPTG-inducible replicative expression vector for

pBS0KPspac, an IPTG-inducible replicative expression vector for Bacillus subtilis. It is replicative both in E.coli and B.subtilis. It has an ampicillin resistance for cloning in E.coli and kanamycin resistance for selection in B. subtilis. The multiple cloning site is downstream of a P_spac promoter, that is inducible with IPTG (Isopropyl-β-D-thiogalactopyranosid).

pSB_Bs0K-P_spac is a replicative expression vector with a kanamycin resistance. The IPTG (isopropylbeta-D-thiogalactopyranoside)-inducible Promoter P_spac is followed by the multiple cloning site and a terminator. Also expressed are lacY, a transporter for IPTG (naturally allolactose), and lac, the repressor. In presence of IPTG, LacI releases from the promoter and the gene of interest is expressed.

The ble gene encodes the bleomycin resisitance protein (BRP) which can be selected for by bleomycine or phleomycin in E. coli and B. subtilis. We did not use this resistance.

The presence of the vector can be checked for via colony PCR with the primers: CTACATCCAGAACAACCTCTGC and TTCGGAAGGAAATGATGACCTC. This backbone is a BioBricked version of the B. subtilis overexpression vector pDG148. Reference: [http://www.ncbi.nlm.nih.gov/pubmed/11728721 Joseph et al.] For handling of B. subtilis vectors, please see here. The transformation into B. subtilis is explained here. This is the "repaired" version of pSB_Bs0K-P_spac, where a single nucleotide loss of the lacI gene was reintroduced. We tested its expression by inserting gfp into the MCS downstream of P_spac and transforming the plasmid into B. subtilis W168. Two independent clones were induced with 0, 0.1 or 2 µM IPTG and checked for fluorescence under the microscope. The fluorescence intensity of at least 100 cells was measured with imageJ.

lacZ-activity in Miller units in pSB_Bs0K-P_spac depending on B. subtilis growth phase.

The vector is now IPTG-inducible, but high induction only leads to low and heterogenous gene expression.

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
INCOMPATIBLE WITH RFC[12]
Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 8268
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NotI site found at 9
Illegal NotI site found at 8274
21
INCOMPATIBLE WITH RFC[21]
Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 8268
Illegal BglII site found at 5862
Illegal BamHI site found at 1378
23
INCOMPATIBLE WITH RFC[23]
Illegal prefix found at 8268
Illegal suffix found at 2
25
INCOMPATIBLE WITH RFC[25]
Illegal prefix found at 8268
Plasmid lacks a suffix.
Illegal XbaI site found at 8283
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NgoMIV site found at 2925
Illegal AgeI site found at 5473
Illegal AgeI site found at 6435
Illegal AgeI site found at 7110
1000
INCOMPATIBLE WITH RFC[1000]
Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal BsaI.rc site found at 2749
Illegal BsaI.rc site found at 4188
Illegal BsaI.rc site found at 6704
Illegal SapI site found at 1666
Illegal SapI.rc site found at 5686

@@ Line 9: / Line 9: @@
 pSB<sub>''Bs''</sub>0K-P<sub><i>spac</i></sub> is a replicative expression vector with a kanamycin resistance. The IPTG (isopropylbeta-D-thiogalactopyranoside)-inducible Promoter P<sub>''spac''</sub> is followed by the multiple cloning site and a terminator. Also expressed are ''lac''Y, a transporter for IPTG (naturally allolactose), and ''lac'', the repressor. In presence of IPTG, LacI releases from the promoter and the gene of interest is expressed.
 </p>
 <p align="justify">
 The ''ble'' gene encodes the bleomycin resisitance protein (BRP) which can be selected for by bleomycine or phleomycin in ''E. coli'' and ''B. subtilis''. We did not use this resistance.
 </p>
 <p align="justify">
 The presence of the vector can be checked for via colony PCR with the primers: CTACATCCAGAACAACCTCTGC and TTCGGAAGGAAATGATGACCTC.
@@ Line 25: / Line 27: @@
 This is the "repaired" version of [https://parts.igem.org/Part:BBa_K823026 pSB<sub>Bs</sub>0K-P<sub>spac</sub>], where a single nucleotide loss of the lacI gene was reintroduced.
-The vector is now IPTG-inducible, but high induction only leads to low and heterogenous gene expression.
-We tested its expression by inserting gfp into the MCS downstream of P<sub>spac</sub>.
+We tested its expression by inserting [https://parts.igem.org/Part:BBa_K823039 ''gfp''] into the MCS downstream of P<sub>spac</sub> and transforming the plasmid into ''B. subtilis'' W168. Two independent clones were induced with 0, 0.1 or 2 µM IPTG and checked for fluorescence under the microscope. The fluorescence intensity of at least 100 cells was measured with imageJ.
+{| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
+| style="width: 70%;background-color: #EBFCE4;" |
+{|
+|[[Image:LMU14_PBS0KPspac-activity.png|500px|center]]
+|-
+| style="width: 70%;background-color: #EBFCE4;" |
+{| style="color:black;" cellpadding="0" width="70%" cellspacing="0" border="0" align="center" style="text-align:center;"
+|style="width: 70%;background-color: #EBFCE4;" |
+<font color="#000000"; size="2">''lacZ''-activity in Miller units in pSB<sub>Bs</sub>0K-P<sub>''spac''</sub> depending on ''B. subtilis'' growth phase.</font>
+|}
+|}
+|}
+The vector is now IPTG-inducible, but high induction only leads to low and heterogenous gene expression.
 <!-- Add more about the biology of this part here