Difference between revisions of "Part:BBa K1431401"
(→characterization) |
|||
| Line 11: | Line 11: | ||
| − | + | == Introduction == | |
| + | |||
'''CRISPR(Clustered Regularly Interspaced Short Palindromic Repeat)/Cas System''' is a hot topic for biology research these days. Recently we see dozens of papers published in top journals addressing this intersting field. In case you are not familiar with it, I quoted those lines full of jargons from Wikipedia: | '''CRISPR(Clustered Regularly Interspaced Short Palindromic Repeat)/Cas System''' is a hot topic for biology research these days. Recently we see dozens of papers published in top journals addressing this intersting field. In case you are not familiar with it, I quoted those lines full of jargons from Wikipedia: | ||
| Line 23: | Line 24: | ||
Moreover, TALENs require a significantly longer time to construct<sup>[http://indepth.systembio.com/cas9-crispr-faq/what-is-the-difference-between-cas9-crispr-and-talen SystemBio]</sup>. | Moreover, TALENs require a significantly longer time to construct<sup>[http://indepth.systembio.com/cas9-crispr-faq/what-is-the-difference-between-cas9-crispr-and-talen SystemBio]</sup>. | ||
| − | + | ||
| + | == CRISPR gRNA Basics == | ||
| + | |||
As mentioned above, CRISPR/Cas9 Systems need a gRNA(Guide RNA) sequence to identify the target<sup>[http://www.nature.com/nprot/journal/v8/n11/full/nprot.2013.143.html ZhangFCas]</sup>. The gRNA is a 23bp long RNA beginning with a 3bp PAM(Protospacer Adjacent Motif) sequence. To effectively and specifically target a gene, the remaining 20bp of gRNA have to match the target sequence strictly. According to [http://crispr.mit.edu/about ZhangTool], the approximate quality of gRNA can be denoted as | As mentioned above, CRISPR/Cas9 Systems need a gRNA(Guide RNA) sequence to identify the target<sup>[http://www.nature.com/nprot/journal/v8/n11/full/nprot.2013.143.html ZhangFCas]</sup>. The gRNA is a 23bp long RNA beginning with a 3bp PAM(Protospacer Adjacent Motif) sequence. To effectively and specifically target a gene, the remaining 20bp of gRNA have to match the target sequence strictly. According to [http://crispr.mit.edu/about ZhangTool], the approximate quality of gRNA can be denoted as | ||
| Line 29: | Line 32: | ||
Remember here that this equation bases only on an approximation of experimental data, and may differ from the actual situation. | Remember here that this equation bases only on an approximation of experimental data, and may differ from the actual situation. | ||
| + | |||
== characterization == | == characterization == | ||
| + | |||
==== Conserved Sequence Analysis ==== | ==== Conserved Sequence Analysis ==== | ||
| Line 354: | Line 359: | ||
| − | + | ||
| + | == Usage and Biology == | ||
| + | |||
<!-- --> | <!-- --> | ||
| Line 362: | Line 369: | ||
<!-- Uncomment this to enable Functional Parameter display | <!-- Uncomment this to enable Functional Parameter display | ||
| − | + | ||
| + | == Functional Parameters == | ||
| + | |||
<partinfo>BBa_K1431401 parameters</partinfo> | <partinfo>BBa_K1431401 parameters</partinfo> | ||
<!-- --> | <!-- --> | ||
Revision as of 18:44, 17 October 2014
One gRNA Sequence for HIV-1
This is a gRNA for the HIV-1 Virus, designed by the 2014 iGEM Team SUSTC-Shenzhen.
Here, we engineer the type II CRISPR system to come true double strands break with gRNA in hela cells.We show that this process relies on CRISPR two specificity components:gRNA and its binding target-sequence.
In this part, we put on a high-specificity gRNA of HIV with more detail in design.
In addition ,this part use efficient BbsI restriction site for easily used.
Introduction
CRISPR(Clustered Regularly Interspaced Short Palindromic Repeat)/Cas System is a hot topic for biology research these days. Recently we see dozens of papers published in top journals addressing this intersting field. In case you are not familiar with it, I quoted those lines full of jargons from Wikipedia:
CRISPRs are DNA loci containing short repetitions of base sequences. Each repetition is followed by short segments of "spacer DNA" from previous exposures to a virus.
The CRISPR/Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides a form of acquired immunity. CRISPR spacers recognize and silence these exogenous genetic elements like RNAi in eukaryotic organisms.
Since 2012, the CRISPR/Cas system has been used for gene editing (silencing, enhancing or changing specific genes) that even works in eukaryotes like mice and primates. By inserting a plasmid containing cas genes and specifically designed CRISPRs, an organism's genome can be cut at any desired location.
-Wikipedia
In short, CRISPR/Cas System is a tool to edit genes in live cells. Similar tools include TALEN(Transcription activator-like effector nuclease) and ZFN(Zinc Finger Nuclease). But CRISPR/Cas is superior than those methods in that CRISPR/Cas is guided by short RNA chain (~23bp), which is obviously easier to synthesize.
Moreover, TALENs require a significantly longer time to construct[http://indepth.systembio.com/cas9-crispr-faq/what-is-the-difference-between-cas9-crispr-and-talen SystemBio].
CRISPR gRNA Basics
As mentioned above, CRISPR/Cas9 Systems need a gRNA(Guide RNA) sequence to identify the target[http://www.nature.com/nprot/journal/v8/n11/full/nprot.2013.143.html ZhangFCas]. The gRNA is a 23bp long RNA beginning with a 3bp PAM(Protospacer Adjacent Motif) sequence. To effectively and specifically target a gene, the remaining 20bp of gRNA have to match the target sequence strictly. According to [http://crispr.mit.edu/about ZhangTool], the approximate quality of gRNA can be denoted as
.
Remember here that this equation bases only on an approximation of experimental data, and may differ from the actual situation.
characterization
Conserved Sequence Analysis
We first extracted all conserved regions from the NIH HIV-1 Reference Genome. In this step, we found around 10 alternatives for the next process. Here all screening processes are done in a per-strain basis because of the high mutability of the HIV-1 virus.
Strip out sequences without PAM
| Supplementary Table 1 - Base Percentage of HIV-1 Aligned Genome 730bp-752bp | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| A % | G % | C % | T % | Empty % | Non Empty % | A(Corrected) | G(Corrected) | C(Corrected) | T(Corrected) | |
| 730 | 0 | 0 | 0 | 56.47 | 43.53 | 56.47 | 0.00% | 0.00% | 0.00% | 100.00% |
| 731 | 0 | 55.88 | 0 | 0.59 | 43.53 | 56.47 | 0.00% | 98.96% | 0.00% | 1.04% |
| 732 | 0 | 0 | 0 | 56.47 | 43.53 | 56.47 | 0.00% | 0.00% | 0.00% | 100.00% |
| 733 | 0 | 54.71 | 0 | 1.18 | 43.53 | 55.89 | 0.00% | 97.89% | 0.00% | 2.11% |
| 734 | 0 | 0 | 0 | 58.24 | 41.76 | 58.24 | 0.00% | 0.00% | 0.00% | 100.00% |
| 735 | 56.47 | 0.59 | 0.59 | 0.59 | 41.76 | 58.24 | 96.96% | 1.01% | 1.01% | 1.01% |
| 736 | 0 | 1.18 | 57.06 | 0 | 41.76 | 58.24 | 0.00% | 2.03% | 97.97% | 0.00% |
| 737 | 1.18 | 57.06 | 0 | 0.59 | 41.18 | 58.83 | 2.01% | 96.99% | 0.00% | 1.00% |
| 738 | 60 | 0 | 0 | 0 | 40 | 60 | 100.00% | 0.00% | 0.00% | 0.00% |
| 739 | 0.59 | 0 | 58.82 | 0 | 40 | 59.41 | 0.99% | 0.00% | 99.01% | 0.00% |
| 740 | 0 | 0 | 0 | 0 | 100 | 0 | ||||
| 741 | 0 | 0 | 0 | 0 | 100 | 0 | ||||
| 742 | 0.59 | 0 | 1.18 | 58.24 | 40 | 60.01 | 0.98% | 0.00% | 1.97% | 97.05% |
| 743 | 0 | 0 | 60 | 0 | 40 | 60 | 0.00% | 0.00% | 100.00% | 0.00% |
| 744 | 0 | 1.18 | 58.82 | 0 | 40 | 60 | 0.00% | 1.97% | 98.03% | 0.00% |
| 745 | 0 | 58.82 | 1.18 | 0 | 40 | 60 | 0.00% | 98.03% | 1.97% | 0.00% |
| 746 | 0.59 | 0 | 59.41 | 0 | 40 | 60 | 0.98% | 0.00% | 99.02% | 0.00% |
| 747 | 0.59 | 59.41 | 0 | 0 | 40 | 60 | 0.98% | 99.02% | 0.00% | 0.00% |
| 748 | 0.59 | 59.41 | 0 | 0 | 40 | 60 | 0.98% | 99.02% | 0.00% | 0.00% |
| 749 | 0 | 58.82 | 0.59 | 0.59 | 40 | 60 | 0.00% | 98.03% | 0.98% | 0.98% |
| 750 | 0.59 | 0.59 | 58.24 | 0.59 | 40 | 60.01 | 0.98% | 0.98% | 97.05% | 0.98% |
| 751 | 60 | 0 | 0 | 0 | 40 | 60 | 100.00% | 0.00% | 0.00% | 0.00% |
| 752 | 59.41 | 0.59 | 0 | 0 | 40 | 60 | 99.02% | 0.98% | 0.00% | 0.00% |
Select gRNA sequences with the best theoretical quality
| HIV-1 Quasi-Conservative gRNAs(Useful) | ||||
|---|---|---|---|---|
| Sequence | Rating(Zhang) | Rank(Church) | Free Energy(Approx.) | |
| GTGTGGAAAATCTCTAGCAGTGG | 71 | - | -1.4 | HIV1_REF_2010 |
| TCTAGCAGTGGCGCCCGAACAGG | 97 | - | -1.3 | |
Usage and Biology
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]