Difference between revisions of "Part:BBa K1431401:Design"
Line 10: Line 10:
  
 
The whole process can be divided into the following steps:
 
The whole process can be divided into the following steps:
−
==== Conserved Sequence Analysis ====
 
−
 
−
We first extracted all conserved regions from the NIH HIV-1 Reference Genome. In this step, we found around 10 alternatives for the next process. Here all screening processes are done in a per-strain basis because of the high mutability of the HIV-1 virus.
 
−
 
−
==== Strip out sequences without PAM ====
 
−
 
−
{| class="wikitable"
 
−
! colspan="11" | Supplementary Table 1 - Base Percentage of HIV-1 Aligned Genome 730bp-752bp
 
−
|-
 
−
|
 
−
| A %
 
−
| G %
 
−
| C %
 
−
| T %
 
−
| Empty %
 
−
| Non Empty %
 
−
| A(Corrected)
 
−
| G(Corrected)
 
−
| C(Corrected)
 
−
| T(Corrected)
 
−
|-
 
−
| 730
 
−
| 0
 
−
| 0
 
−
| 0
 
−
| 56.47
 
−
| 43.53
 
−
| 56.47
 
−
| 0.00%
 
−
| 0.00%
 
−
| 0.00%
 
−
| 100.00%
 
−
|-
 
−
| 731
 
−
| 0
 
−
| 55.88
 
−
| 0
 
−
| 0.59
 
−
| 43.53
 
−
| 56.47
 
−
| 0.00%
 
−
| 98.96%
 
−
| 0.00%
 
−
| 1.04%
 
−
|-
 
−
| 732
 
−
| 0
 
−
| 0
 
−
| 0
 
−
| 56.47
 
−
| 43.53
 
−
| 56.47
 
−
| 0.00%
 
−
| 0.00%
 
−
| 0.00%
 
−
| 100.00%
 
−
|-
 
−
| 733
 
−
| 0
 
−
| 54.71
 
−
| 0
 
−
| 1.18
 
−
| 43.53
 
−
| 55.89
 
−
| 0.00%
 
−
| 97.89%
 
−
| 0.00%
 
−
| 2.11%
 
−
|-
 
−
| 734
 
−
| 0
 
−
| 0
 
−
| 0
 
−
| 58.24
 
−
| 41.76
 
−
| 58.24
 
−
| 0.00%
 
−
| 0.00%
 
−
| 0.00%
 
−
| 100.00%
 
−
|-
 
−
| 735
 
−
| 56.47
 
−
| 0.59
 
−
| 0.59
 
−
| 0.59
 
−
| 41.76
 
−
| 58.24
 
−
| 96.96%
 
−
| 1.01%
 
−
| 1.01%
 
−
| 1.01%
 
−
|-
 
−
| 736
 
−
| 0
 
−
| 1.18
 
−
| 57.06
 
−
| 0
 
−
| 41.76
 
−
| 58.24
 
−
| 0.00%
 
−
| 2.03%
 
−
| 97.97%
 
−
| 0.00%
 
−
|-
 
−
| 737
 
−
| 1.18
 
−
| 57.06
 
−
| 0
 
−
| 0.59
 
−
| 41.18
 
−
| 58.83
 
−
| 2.01%
 
−
| 96.99%
 
−
| 0.00%
 
−
| 1.00%
 
−
|-
 
−
| 738
 
−
| 60
 
−
| 0
 
−
| 0
 
−
| 0
 
−
| 40
 
−
| 60
 
−
| 100.00%
 
−
| 0.00%
 
−
| 0.00%
 
−
| 0.00%
 
−
|-
 
−
| 739
 
−
| 0.59
 
−
| 0
 
−
| 58.82
 
−
| 0
 
−
| 40
 
−
| 59.41
 
−
| 0.99%
 
−
| 0.00%
 
−
| 99.01%
 
−
| 0.00%
 
−
|-
 
−
| 740
 
−
| 0
 
−
| 0
 
−
| 0
 
−
| 0
 
−
| 100
 
−
| 0
 
−
|
 
−
|
 
−
|
 
−
|
 
−
|-
 
−
| 741
 
−
| 0
 
−
| 0
 
−
| 0
 
−
| 0
 
−
| 100
 
−
| 0
 
−
|
 
−
|
 
−
|
 
−
|
 
−
|-
 
−
| 742
 
−
| 0.59
 
−
| 0
 
−
| 1.18
 
−
| 58.24
 
−
| 40
 
−
| 60.01
 
−
| 0.98%
 
−
| 0.00%
 
−
| 1.97%
 
−
| 97.05%
 
−
|-
 
−
| 743
 
−
| 0
 
−
| 0
 
−
| 60
 
−
| 0
 
−
| 40
 
−
| 60
 
−
| 0.00%
 
−
| 0.00%
 
−
| 100.00%
 
−
| 0.00%
 
−
|-
 
−
| 744
 
−
| 0
 
−
| 1.18
 
−
| 58.82
 
−
| 0
 
−
| 40
 
−
| 60
 
−
| 0.00%
 
−
| 1.97%
 
−
| 98.03%
 
−
| 0.00%
 
−
|-
 
−
| 745
 
−
| 0
 
−
| 58.82
 
−
| 1.18
 
−
| 0
 
−
| 40
 
−
| 60
 
−
| 0.00%
 
−
| 98.03%
 
−
| 1.97%
 
−
| 0.00%
 
−
|-
 
−
| 746
 
−
| 0.59
 
−
| 0
 
−
| 59.41
 
−
| 0
 
−
| 40
 
−
| 60
 
−
| 0.98%
 
−
| 0.00%
 
−
| 99.02%
 
−
| 0.00%
 
−
|-
 
−
| 747
 
−
| 0.59
 
−
| 59.41
 
−
| 0
 
−
| 0
 
−
| 40
 
−
| 60
 
−
| 0.98%
 
−
| 99.02%
 
−
| 0.00%
 
−
| 0.00%
 
−
|-
 
−
| 748
 
−
| 0.59
 
−
| 59.41
 
−
| 0
 
−
| 0
 
−
| 40
 
−
| 60
 
−
| 0.98%
 
−
| 99.02%
 
−
| 0.00%
 
−
| 0.00%
 
−
|-
 
−
| 749
 
−
| 0
 
−
| 58.82
 
−
| 0.59
 
−
| 0.59
 
−
| 40
 
−
| 60
 
−
| 0.00%
 
−
| 98.03%
 
−
| 0.98%
 
−
| 0.98%
 
−
|-
 
−
| 750
 
−
| 0.59
 
−
| 0.59
 
−
| 58.24
 
−
| 0.59
 
−
| 40
 
−
| 60.01
 
−
| 0.98%
 
−
| 0.98%
 
−
| 97.05%
 
−
| 0.98%
 
−
|-
 
−
| 751
 
−
| 60
 
−
| 0
 
−
| 0
 
−
| 0
 
−
| 40
 
−
| 60
 
−
| 100.00%
 
−
| 0.00%
 
−
| 0.00%
 
−
| 0.00%
 
−
|-
 
−
| 752
 
−
| 59.41
 
−
| 0.59
 
−
| 0
 
−
| 0
 
−
| 40
 
−
| 60
 
−
| 99.02%
 
−
| 0.98%
 
−
| 0.00%
 
−
| 0.00%
 
−
|}
 
−
 
−
==== Select gRNA sequences with the best theoretical quality ====
 
−
 
−
{| class="wikitable"
 
−
! colspan="5" | HIV-1 Quasi-Conservative gRNAs(Useful)
 
−
|-
 
−
| Sequence
 
−
| Rating(Zhang)
 
−
| Rank(Church)
 
−
| Free Energy(Approx.)
 
−
|
 
−
|-
 
−
| GTGTGGAAAATCTCTAGCAGTGG
 
−
| 71
 
−
| -
 
−
| -1.4
 
−
| rowspan="2" | HIV1_REF_2010
 
−
|-
 
−
| TCTAGCAGTGGCGCCCGAACAGG
 
−
| 97
 
−
| -
 
−
| -1.3
 
−
|}
 
  
 
===Source===
 
===Source===

Revision as of 18:36, 17 October 2014

One gRNA Sequence for HIV-1


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Designing the Sequence

We used a method derived from the method described in the paper by Feng Zhang[http://www.nature.com/nbt/journal/v31/n9/abs/nbt.2647.html ZhangFgRNA].

The whole process can be divided into the following steps:

Source

Conserved Region of the HIV-1 Genome from the NIH HIV-1 Sequence Database

References