Difference between revisions of "Part:BBa K1323000"

Revision as of 23:43, 16 October 2014

sgRNA (1): CRISPR Silencing of YFP

Sequence and Features

Assembly Compatibility:

@@ Line 2: / Line 2: @@
 <partinfo>BBa_K1323000 short</partinfo>
-life is awesome
 <!-- Add more about the biology of this part here
 ===Usage and Biology===
+Single guide RNA1 is an RNA oligo that binds to dCAS9 (BBa_K1323002) enabling the complex to bind to the coding strand of the YFP ORF (ccatctaattcaaccaaaat). sgRNA is a fusion of tracrRNA (trans-activation crRNA) and crRNA (CRISPR RNA), where the 20bp sequence complementary to the target sequence is linked to a hairpin loop that is similar to tracrRNA. When sgRNA-dCas9 bind to the target sequence, it is expected to act as a programmable repressor and silence the expression of the gene.
 <!-- -->