Difference between revisions of "Part:BBa K1442116:Design"
| Line 1: | Line 1: | ||
| − | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K1442116 short</partinfo> | <partinfo>BBa_K1442116 short</partinfo> | ||
| Line 6: | Line 5: | ||
| − | === | + | |
| + | == Image of sequence == | ||
| + | |||
| + | [[File:Promoters_Diagram.jpg]] | ||
| + | |||
| + | |||
| + | == DNA == | ||
| + | |||
| + | 5’ GGACGCATGGGCTTGCATAGCAAGTCTAGATATGCGTCCAGAGACCA 3’ | ||
| + | |||
| + | |||
| + | |||
| + | == RNA and secondary structure == | ||
| + | |||
| + | [[File:SLC8.png]] | ||
| + | |||
| + | |||
| + | == Features == | ||
| + | |||
| + | [[File:1Paper.jpg]] | ||
| + | |||
Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency to produce strands of wrong size. SLC8 (lane 9) is performs very well in directing replication of the full template and produces a small amount of products with an incorrect size. | Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency to produce strands of wrong size. SLC8 (lane 9) is performs very well in directing replication of the full template and produces a small amount of products with an incorrect size. | ||
| + | |||
| + | == Ribozyme == | ||
| + | |||
| + | The use of a ribozyme is necessitated due to the complicated binding process between the RNA template and the RdRP. In order to optimise the process and avoid any risk of unfavourable secondary structures or obstruction by unneeded nucleotides, a self-cleaving ribozyme was put after the RNA promoter. The rationale being that after transctiption (either in vitro for human cell tests or in vivo for e-coli tests), any added bases as a result of the T7 polymerase would be removed from the main template strand. | ||
| + | |||
| + | [[File:Rib1.gif]] | ||
| + | |||
| + | The chosen ribozyme taken from the Hepatitis Delta virus was investigated at length by the team of J. Doudna and is reported to be the fastest naturally occurring self-cleaving protein. It also functions independently, without the need for adding chemical substances, and is resistant to denaturants. Its close genetic origin to the RdRP also contributes to a better working and more compatible system. | ||
| + | |||
| + | The structure of the molecule and its active site in particular are shown below. | ||
| + | |||
| + | [[File:Rib2.gif]] | ||
===Source=== | ===Source=== | ||
| + | B. Heinz, C. Kao – “Template Requirements for RNA Synthesis by a Recombinant Hepatitis C Virus RNA-Dependent RNA Polymerase” - [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC113194/] | ||
| + | |||
| + | “Crystal structure of a hepatitis delta virus ribozyme”, 1998, Adrian R. Ferré-D'Amaré, Kaihong Zhou and Jennifer A. Doudna | ||
Brome Mosaic Virus | Brome Mosaic Virus | ||
===References=== | ===References=== | ||
Latest revision as of 13:55, 16 October 2014
SLC8 3
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 33
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 33
- 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 33
Illegal NgoMIV site found at 57
Illegal NgoMIV site found at 86 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 49
Image of sequence
DNA
5’ GGACGCATGGGCTTGCATAGCAAGTCTAGATATGCGTCCAGAGACCA 3’
RNA and secondary structure
Features
Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency to produce strands of wrong size. SLC8 (lane 9) is performs very well in directing replication of the full template and produces a small amount of products with an incorrect size.
Ribozyme
The use of a ribozyme is necessitated due to the complicated binding process between the RNA template and the RdRP. In order to optimise the process and avoid any risk of unfavourable secondary structures or obstruction by unneeded nucleotides, a self-cleaving ribozyme was put after the RNA promoter. The rationale being that after transctiption (either in vitro for human cell tests or in vivo for e-coli tests), any added bases as a result of the T7 polymerase would be removed from the main template strand.
The chosen ribozyme taken from the Hepatitis Delta virus was investigated at length by the team of J. Doudna and is reported to be the fastest naturally occurring self-cleaving protein. It also functions independently, without the need for adding chemical substances, and is resistant to denaturants. Its close genetic origin to the RdRP also contributes to a better working and more compatible system.
The structure of the molecule and its active site in particular are shown below.
Source
B. Heinz, C. Kao – “Template Requirements for RNA Synthesis by a Recombinant Hepatitis C Virus RNA-Dependent RNA Polymerase” - [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC113194/]
“Crystal structure of a hepatitis delta virus ribozyme”, 1998, Adrian R. Ferré-D'Amaré, Kaihong Zhou and Jennifer A. Doudna
Brome Mosaic Virus