Difference between revisions of "Part:BBa K1442115:Design"

 
 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1442115 short</partinfo>
 
<partinfo>BBa_K1442115 short</partinfo>
Line 6: Line 5:
  
  
−
===Design Notes===
+
== Image of sequence ==
−
Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency promoters to produce strands of wrong size. C2 (band 8) shows considerable efficiency in directing replication of the full template, although an amount of incorrect products were also present.
+
 
 +
[[File:Promoters_Diagram.jpg]]
 +
 
 +
 
 +
== DNA ==
 +
 
 +
5’ GGATTGAACCTCGTTCCGTGGTTTACG 3’
 +
 
 +
 
 +
 
 +
== RNA and secondary structure ==
 +
 
 +
[[File:B2RNA.png]]
 +
 
 +
 
 +
== Features ==
 +
 
 +
[[File:1Paper.jpg]]
 +
 
 +
Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency to produce strands of wrong size. B2 (lane 7) is extremely efficient in directing replication of the full template and produces very little products with an incorrect size.
 +
 
 +
== Ribozyme ==
 +
 
 +
The use of a ribozyme is necessitated due to the complicated binding process between the RNA template and the RdRP. In order to optimise the process and avoid any risk of unfavourable secondary structures or obstruction by unneeded nucleotides, a self-cleaving ribozyme was put after the RNA promoter. The rationale being that after transctiption (either in vitro for human cell tests or in vivo for e-coli tests), any added bases as a result of the T7 polymerase would be removed from the main template strand.
 +
 
 +
[[File:Rib1.gif]]
 +
 
 +
The chosen ribozyme taken from the Hepatitis Delta virus was investigated at length by the team of J. Doudna  and is reported to be the fastest naturally occurring self-cleaving protein. It also functions independently, without the need for adding chemical substances, and is resistant to denaturants. Its close genetic origin to the RdRP also contributes to a better working and more compatible system.
 +
 
 +
The structure of the molecule and its active site in particular are shown below.
  
 +
[[File:Rib2.gif]]
  
  
 
===Source===
 
===Source===
 +
B. Heinz, C. Kao – “Template Requirements for RNA Synthesis by a Recombinant Hepatitis C Virus RNA-Dependent RNA Polymerase” - [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC113194/]
  
−
Cytomegalovirus RNA3
+
“Crystal structure of a hepatitis delta virus ribozyme”, 1998, Adrian R. Ferré-D'Amaré, Kaihong Zhou and Jennifer A. Doudna
  
 
===References===
 
===References===

Latest revision as of 13:29, 16 October 2014

B2 3


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 35
    Illegal NgoMIV site found at 64
  • 1000
    COMPATIBLE WITH RFC[1000]


Image of sequence

Promoters Diagram.jpg


DNA

5’ GGATTGAACCTCGTTCCGTGGTTTACG 3’


RNA and secondary structure

B2RNA.png


Features

1Paper.jpg

Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency to produce strands of wrong size. B2 (lane 7) is extremely efficient in directing replication of the full template and produces very little products with an incorrect size.

Ribozyme

The use of a ribozyme is necessitated due to the complicated binding process between the RNA template and the RdRP. In order to optimise the process and avoid any risk of unfavourable secondary structures or obstruction by unneeded nucleotides, a self-cleaving ribozyme was put after the RNA promoter. The rationale being that after transctiption (either in vitro for human cell tests or in vivo for e-coli tests), any added bases as a result of the T7 polymerase would be removed from the main template strand.

Rib1.gif

The chosen ribozyme taken from the Hepatitis Delta virus was investigated at length by the team of J. Doudna and is reported to be the fastest naturally occurring self-cleaving protein. It also functions independently, without the need for adding chemical substances, and is resistant to denaturants. Its close genetic origin to the RdRP also contributes to a better working and more compatible system.

The structure of the molecule and its active site in particular are shown below.

Rib2.gif


Source

B. Heinz, C. Kao – “Template Requirements for RNA Synthesis by a Recombinant Hepatitis C Virus RNA-Dependent RNA Polymerase” - [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC113194/]

“Crystal structure of a hepatitis delta virus ribozyme”, 1998, Adrian R. Ferré-D'Amaré, Kaihong Zhou and Jennifer A. Doudna

References