Difference between revisions of "Part:BBa K1442100"
Line 53: | Line 53: | ||
https://static.igem.org/mediawiki/2014/0/0d/Graph1hcv.png | https://static.igem.org/mediawiki/2014/0/0d/Graph1hcv.png | ||
− | Figure | + | Figure 6. Characterization of mRdRp and RdRp activity with S3, R5 and C2/HP 3’ UTRs. Data was collected at different time points using Tecan Microplate reader. Controls also present: (IPTG + RBS + GFP) and NEB only. |
Table 1. RNA dependent RNA polymerase activity following induction at 0.2 and 0.4 OD, relative to control wells (not induced at 0.2 and 0.4 OD). Error bars indicate standard error. | Table 1. RNA dependent RNA polymerase activity following induction at 0.2 and 0.4 OD, relative to control wells (not induced at 0.2 and 0.4 OD). Error bars indicate standard error. | ||
Line 63: | Line 63: | ||
https://static.igem.org/mediawiki/2014/6/64/Rdrp_linear_graph.png | https://static.igem.org/mediawiki/2014/6/64/Rdrp_linear_graph.png | ||
− | Figure | + | Figure 7. RNA dependent RNA polymerase activity following induction at 0.2 and 0.4 OD, relative to control wells (not induced at 0.2 and 0.4 OD). |
https://static.igem.org/mediawiki/2014/3/38/Rdrpgraph3.png | https://static.igem.org/mediawiki/2014/3/38/Rdrpgraph3.png | ||
− | Figure | + | Figure 8. RNA dependent RNA polymerase activity following induction at 0.2 and 0.4 OD. Rates were extracted by linear regression and is displayed. Error bars indicate standard error of the mean. |
<!-- --> | <!-- --> |
Revision as of 19:57, 15 October 2014
RdRP
RNA Dependent RNA Polymerase (RdRp)
Background
RNA dependent RNA polymerase (RdRp) is an enzyme which catalyses the replication of RNA from an RNA template. An essential protein encoded within viruses that lack a DNA phase and replicate using negative sense RNA. The submitted RdRp part derives from the Hepatitis C virus con1 strain, RdRp is also referred to as non-structural protein 5B (NS5B). Part sequence was derived from Lohmann et al., 1997, with the authors achieving full expression and activity of RdRp in a baculovirus expression system. Membrane association of RdRp is essential for replication of HCV subgenomic regions, with the C-terminal tail containing 21 amino acids which confer high hydrophobicity and mediate insertion into the membrane (Moradpour et., 2004). The C-terminal tail preceding the C-terminal hydrophobic insertion sequence interacts with structural elements including the β-hairpin loop of NS5b (Leveque et al., 2003). The β-hairpin loop inserts into the active site, believed to position the 3’ terminius of HCV viral RNA to initiate RNA synthesis (Hong et al., 2001). RdRp initiates RNA synthesis with nucleotide transfer activity found within the palm motif (Figure 1a & b), with several amino acid residues implicated in nucleotide triphosphate contact (Bressanelli et al., 2002). RdRp requires 5’ and 3’ untranslated regions (UTRs) found within the HCV genome to direct RNA synthesis. The UTRs form ordered RNA structures and are evolutionary conserved.
Figure 1. Ribbon diagram of HCV RNA polymerase (NS5B). (left) Molecular surface rendering of NS5B. Images depict the palm, thumb and fingers domain of the RNA dependent RNA polymerase. Taken from (O’Farrell et al., 2003) http://www.ncbi.nlm.nih.gov/pubmed/12589751
Design Notes
• The 21 amino acid residues have been removed in the part sequence, ensuring cytoplasmic RdRp activity, this ensures no anchoring to the endoplasmic reticulum in human cells (Lai et al., 2004). This modification has no major effect on RdRp activity, which is complimented by previous analysis showing no significant loss of nucleotide polymerization activity (Vo et al., 2004). • A single point mutation has been introduced at position 2884, where a guanine has replaced a cytosine. This confers an Arginine to glycine substitution, which increases the number of transformed colonies obtained (Bartenschlager et al., 2001). • A PstI restriction site was removed in the part sequence (CTGCAG) and was altered to CTCCAG to allow bio brick compatibility. Experimental Design
To characterize the RNA dependent RNA polymerase, constructs with 3’ untranslated regions (UTRs) in combination with a Reverse GFP were introduced in E. coli. The 3’ UTRs comprise previously used DNA sequences that promote RdRp activity. Further information on the 3’ UTRs is below (n.b. only some of the 3’ UTRs listed below have been stably transformed and been used to characterize mRdRp and RdRp activity.
B2(−)26G 5’ GGATTGAACCTCGTTCCGTGGTTTACG 3’
C2(−)29G 5’ GGTTGAACCGTACGCCTTTGTAAATAAACG 3’
SLC+8 5’ GGACGCATGGGCTTGCATAGCAAGTCTAGATATGCGTCCAGAGACCA 3’
SLdel+8 5’ GGCTTGCATAGCAAGTCTAGATATGCGTCCAGAGACCA 3’
SLD3 5’ GGGCTTGCATAGCAAGTCTGAGACC 3’
Mutant RNA dependent RNA polymerase (mRdRp in Figure 4) was also characterized in tandem with the normal RNA dependent RNA polymerase (RdRp in Figure 3). Mutant RNA dependent RNA polymerase is edited, with the removal of a Bgal1 restriction site in the sequence, as this is not biobrick compatible it has not been uploaded to the registry. Normal RNA dependent RNA polymerase is biobrick compatible.
Figure 3. Construct depiction. Plasmid containing RNA dependent RNA polymerase (RdRp), driven by a T3 promoter in combination with an ampicillin resistance gene for selection of transformant colonies. For clarity, biobrick prefix and suffix sequences not shown.
Figure 4. Construct depiction. Plasmid containing mutant RNA dependent RNA polymerase (RdRp), driven by a T3 promoter in combination with an ampicillin resistance gene for selection of transformant colonies. Mutant RdRp is not biobrick compatible, but has been included as an additional control.
Figure 5. 3’ UTR and Reverse GFP general construct depiction. Plasmid containing reverse GFP and 3’ UTR is depicted below. This was used to characterize RdRp and mRdRp activity in E. coli. 3’ UTRs were interchangeable and are referred to as S3, R5 and C2/HP. 3’ UTRs and Reverse GFP are biobrick compatible. For clarity, biobrick prefix and suffix sequences not shown.
To characterize RdRp and mRdRp activity, co-transformation of the two plasmids with the relevant constructs (Figures 4 & 5) was performed. Table 1 summarizes the experiments and relevant 3’ UTRs tested. Data was obtained using the Tecan micro plate reader
Results
Figure 6. Characterization of mRdRp and RdRp activity with S3, R5 and C2/HP 3’ UTRs. Data was collected at different time points using Tecan Microplate reader. Controls also present: (IPTG + RBS + GFP) and NEB only.
Table 1. RNA dependent RNA polymerase activity following induction at 0.2 and 0.4 OD, relative to control wells (not induced at 0.2 and 0.4 OD). Error bars indicate standard error.
Horizontal axis depicts various different points (1-9: due to the nature of the analysis time in seconds is not displayed). RdRp induction at 0.2 and 0.4 OD at points 1-3 indicates initial activity and relative increase in fluorescence output. Initial RdRp activity then decays following induction, with decrease in fluorescence activity at both OD 0.2 and 0.4. Conclusively, results suggest initial induction of RdRp activity causes a relative increase in fluorescence with a stabilization/decrease thereafter.
Figure 7. RNA dependent RNA polymerase activity following induction at 0.2 and 0.4 OD, relative to control wells (not induced at 0.2 and 0.4 OD).
Figure 8. RNA dependent RNA polymerase activity following induction at 0.2 and 0.4 OD. Rates were extracted by linear regression and is displayed. Error bars indicate standard error of the mean.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 492
Illegal BglII site found at 1340 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 537