Difference between revisions of "Part:BBa K1352006:Experience"
Line 39: Line 39:
  
 
[[File:K1352006 standard digest.PNG|600px|thumb|left|Figure 2]]
 
[[File:K1352006 standard digest.PNG|600px|thumb|left|Figure 2]]
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
  
  
Line 61: Line 71:
  
 
Figure 2; a restriction digest verification of plasmid K1352006
 
Figure 2; a restriction digest verification of plasmid K1352006
 +
 +
 +
 +
 +
 +
 +
 +
 +
  
  
Line 117: Line 136:
  
 
XS. K1352006 plasmid digested with XbaI and Spe1
 
XS. K1352006 plasmid digested with XbaI and Spe1
 +
  
 
DNA Sequencing
 
DNA Sequencing
 +
 
The recombinant plasmid was Sanger-sequenced with the following sequencing primers.  “G101” is a reverse primer, the rest are forward primers.
 
The recombinant plasmid was Sanger-sequenced with the following sequencing primers.  “G101” is a reverse primer, the rest are forward primers.
  
Line 135: Line 156:
 
[[File:MCS in INP-FLAG.PNG|600px|thumb|left|Figure 3]]
 
[[File:MCS in INP-FLAG.PNG|600px|thumb|left|Figure 3]]
 
   
 
   
 +
 +
 +
 +
 +
 +
 +
 +
 +
  
  

Revision as of 15:10, 4 October 2014

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1352006

User Reviews

UNIQ88b8c1fea06c80eb-partinfo-00000000-QINU UNIQ88b8c1fea06c80eb-partinfo-00000001-QINU


Restriction digest + Gel electrophoresis


Figure 1

Figure 1; a Xba1 + HindIII restriction digest screen of recombinants. The recombinant which went on to become K1352006 is in lane 5. The “L” lane is DNA marker (ladder). The arrows are to highlight the distance travelled by the HindIII-negative recombinants.







Figure 2
















Figure 2; a restriction digest verification of plasmid K1352006

























For figure 2: the letters indicate the following:

L. 10,000bp – 500bp DNA marker “ladder”

N. K1352006 plasmid digested with no enzymes

E. K1352006 plasmid digested with EcoRI

X. K1352006 plasmid digested with XbaI

S. K1352006 plasmid digested with SpeI

P. K1352006 plasmid digested with PstI

EP. K1352006 plasmid digested with EcoRI and PstI

XS. K1352006 plasmid digested with XbaI and Spe1


DNA Sequencing

The recombinant plasmid was Sanger-sequenced with the following sequencing primers. “G101” is a reverse primer, the rest are forward primers.

“G101” (attaccgcctttgagtgagc)

“G100” (tgccacctgacgtctaagaa)

“35 INP-SEQ 1” (ccgattcattaatgcagctgg)

“36 INP-SEQ 2” (gaggttgctgttgccgac)

“37 INP-SEQ 3” (ggtgtggaagccgacattc)

The plasmid insert was found to be exactly as desired. Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).

Figure 3













Conclusions The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the N-terminus of the linker sequence after INP. However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies.